Platelets trigger perivascular mast cell degranulation to cause inflammatory responses and tissue injury – Science Advances

Abstract

Platelet responses have been associated with end-organ injury and mortality following complex insults such as cardiac surgery, but how platelets contribute to these pathologies remains unclear. Our studies originated from the observation of microvascular platelet retention in a rat cardiac surgery model. Ensuing work supported the proximity of platelet aggregates with perivascular mast cells (MCs) and demonstrated that platelet activation triggered systemic MC activation. We then identified platelet activating factor (PAF) as the platelet-derived mediator stimulating MCs and, using chimeric animals with platelets defective in PAF generation or MCs lacking PAF receptor, defined the role of this platelet-MC interaction for vascular leakage, shock, and tissue inflammation. In application of these findings, we demonstrated that inhibition of platelet activation in modeled cardiac surgery blunted MC-dependent inflammation and tissue injury. Together, our work identifies a previously undefined mechanism of inflammatory augmentation, in which platelets trigger local and systemic responses through activation of perivascular MCs.

More than 225,000 cardiac surgeries are performed annually in the United States (1). While these procedures provide life-saving corrections of coronary blood flow or valvular abnormalities, the inherent combination of surgical trauma, extracorporeal perfusion, and ischemia/reperfusion (I/R) injury often evoke harmful systemic inflammatory responses (2). These inflammatory responses prominently manifest as acute loss of vascular tone (approximately 25% of patients) (3) but are also linked to an ongoing, high incidence of end-organ damage such as acute kidney injury [up to 54% for all stages (4)]. As a consequence, anti-inflammatory interventions have been identified as a key to improve disease outcomes. Since the underlying basis for inflammatory activation remains poorly defined, appropriate ways to modify inflammation during cardiac surgery have remained elusive.

Platelets are increasingly recognized as circulating immune cells, which intimately associate with activated microvascular endothelia (5) and which have the capacity to markedly influence inflammation through direct cell-cell communications and the secretion of inflammatory mediators [reviewed in (6)]. The occurrence of platelet activation during cardiac surgery is a well-established phenomenon (7), and there is mounting evidence that platelet-dependent inflammatory responses are relevant to patient outcomes. Hence, we have recently observed that platelet responses, measured as a drop in platelet count, are an independent risk factor to acute kidney injury and mortality following coronary bypass grafting surgery (4). However, how platelets contribute to the harmful responses elicited by cardiac surgery remains undefined. Here, we sought to investigate whether platelets have a specific role in activating mast cells (MCs) and to depict the implications of such an interaction in a preclinical model of extracorporeal circulation.

In our previous work, which focused on the early events following cardiopulmonary bypass (CPB), we established that MCs are critical effector cells for injurious and inflammatory responses in a rat model (8) as well as in patients undergoing cardiac surgery (9). These observations linked perioperative inflammatory responses to a cell type that is increasingly recognized as a master regulator of early inflammation (10). Strategically located at endothelial and epithelial interfaces, MCs assume a critical role in organizing responses to pathogens and tissue stress such as I/R through the release of powerful preformed and de-novo synthesized effector molecules, which promote recruitment of inflammatory cells and facilitate their tissue infiltration [reviewed in (10)]. Dysregulated, widespread activation of MCs is a critical determinant of mortality, e.g., in anaphylaxis (11) and hemorrhagic fever (12), by causing shock and vascular leakage. What defines the role of MCs in these pathologies is their close association with blood vessels, which ensures that MC productsbeyond their local tissue effectsact directly on endothelial cells and can enter the circulation to rapidly propagate systemic and distant-site inflammation. The significant MC activation observed during cardiac surgery therefore constitutes an important event, which may lead toward an augmented systemic inflammatory response and singles out MC activation as a novel therapeutic target in the ongoing attempt to blunt harmful inflammation in these patients. However, what causes initial activation of MCs within the complex sequence of events elicited by cardiac surgery remains unknown, limiting our understanding of cardiac surgeryassociated inflammation and, specifically, our ability to develop new therapeutic interventions to improve outcomes.

In the present study, we sought to identify the factor(s) contributing to MC activation during cardiac surgery using CPB circulation. Since MCs have a perivascular location, we investigated the possibility that the MC-activating factor acts from within the circulation.

The rat deep hypothermic circulatory arrest (DHCA) model recapitulates several pathophysiologic stimuli present during cardiac surgery such as (nonpulsatile) CPB, blood contact to artificial surfaces of the extracorporeal circulation, cooling, and whole-body I/R. Using this DHCA model, we have previously demonstrated that one of the earliest signs of tissue injury is evidenced in the intestines and that MCs at this site are crucial effectors of pathology through release of preformed mediators (8). Therefore, we examined this site for signs of increased platelet aggregation after DHCA and observed in hematoxylin and eosin staining several platelet-rich thrombi in small and large intestinal sections (Fig. 1A). This observation was confirmed by immunostaining for the platelet-specific marker CD41 in samples obtained 2 hours after completion of CPB (Fig. 1, B to D). Aggregation of platelets was specifically associated with tissue experiencing injury because no platelet aggregation was observed in the lung and brain, where no appreciable tissue injury was observed at this early time point [(8) and fig. S1]. As a consequence, these findings motivated a more detailed investigation into a possible link between platelet deposition and early MC-mediated injury.

(A) Hematoxylin and eosin staining of rat colons 2 hours after completion of the DHCA model. Arrow indicates platelet-rich thrombus in a small submucosal vessel. Immunofluorescence staining for CD41 (green) in sham (B) or experimental (C and D) animals 2 hours after completion of DHCA model (4,6 diamidino-2-phenylindole nuclear counterstain). Representative images of n = 4 per condition; magnification, 200. (D) Insert in (C) in 600. (E) Z-stack confocal laser scanning micrographs of whole-mount sections (ear) taken from Mcpt5-Cre tdTomatofl/fl mice 60 min after intravenous injection of a collagen and epinephrine mixture. Endogenously expressed tdTomato (red) outlines MCs with additional staining performed against CD41 (green) and CD31 (blue). An animated three-dimensional reconstruction can be viewed in the Supplementary Materials. (F) MC granule staining [tetramethyl rhodamine isothiocyanate (TRITC)avidin, red; arrows indicate released MC granules] reveals activated MCs in close vicinity to intravascular (anti-CD31, blue) platelet aggregates (anti-CD41, green). Representative images of n = 4 per condition. (G) Rectal temperature following collagen and epinephrine injection (CollE) in comparison to anaphylaxis after sensitization with trinitrophenol (TNP)specific IgE and exposure to TNP-conjugated ovalbumin (TNP OVA) or vehicle control treatment. In addition, platelets were activated with a monoclonal antibody against mouse integrin IIb, clone MWReg30 (MWReg). A subset of animals was platelet-depleted before receiving collagen and epinephrine (CollE Plt dplt) or MWReg (MWReg Plt dplt). n = 6 per condition. *P < 0.05 versus vehicle control, two-way ANOVA. (H) Plasma chymase levels following collagen and epinephrine, or MWReg injection or TNP OVA anaphylaxis. Data are represented as the means SD. n = 4 to 6 per condition. *P < 0.05 versus vehicle control and #P < 0.05 versus respective treatment group, one-way ANOVA and Tukeys multiple comparisons test.

Platelets, like MCs, can release large amounts of preformed inflammatory mediators; thus, they have the potential to rapidly initiate responses upon activation (6). We hypothesized that platelets may trigger early MC-mediated tissue injury in the DHCA model through their capacity to directly activate MCs. Since platelets are typically intravascular while MCs are extravascular, we sought to examine how this purported interaction could occur. Using microscopy of whole-mount vascular beds, we examined the spatial relationship between activated platelets and perivascular MCs following platelet activation in Mcpt5-Cre tdTomatofl/fl mice. In these animals, MCs harbor a red fluorescent dye, which allows for direct microscopic visualization. We induced specific activation of platelets in these mice by intravenous administration of a cocktail of collagen and epinephrine, carefully titered to cause systemic platelet activation but not mortality. We then examined the vasculature of the mouse ear for microvascular platelet aggregation using microscopy. We found numerous platelet aggregates at the inner walls of blood vessels in close proximity to perivascular MCs (Fig. 1E). Because the genetic elements of Mcpt5 drive tdTomato expression in MCs, red fluorescence is mostly cytoplasmic and does not readily denote degranulation. Therefore, to evaluate the actual degranulation of MCs, we stained MC granules by using avidin, which is routinely used for MC granule staining (8, 13), and found that several of these MCs showed signs of degranulation (Fig. 1F). To confirm that significant MC activation occurred following platelet activation, we examined collagen and epinephrinetreated mice for signs of shock, a classical manifestation of systemic MC activation. It is known that when mice are subjected to immunoglobulin E (IgE)mediated MC activation, they experience anaphylaxis, which is indicated by a sharp drop in core body temperature (13). We observed that collagen and epinephrinetreated mice experienced a sharp drop in core body temperature, which was attributable to MC activation based on the high levels of chymasea major prestored MC mediator (10)detected in the plasma of these mice (Fig. 1, G and H). To confirm the contribution of platelets to this MC-mediated anaphylaxis response, we depleted platelets before administration of the collagen and epinephrine cocktail and found that it abrogated the hypothermic response (Fig. 1G). Thus, specific activation of platelets results in degranulation of perivascular MCs.

We next investigated the mechanism of platelet-mediated MC activation. The close spatial relationship between platelet aggregates and perivascular MCs on apposing sides of the vasculature raised the possibility that activated platelets release bioactive agents that traverse the endothelial barrier to stimulate MC degranulation. Therefore, we examined whether any secreted products of platelets had MC-activating properties by applying conditioned medium from activated human platelets on to two different human MC lines [ROSA (14) and LAD2 (15)]. Cell-free conditioned medium from platelets activated by either thrombin, collagen, or convulxin, but not from resting platelets, evoked a comparable MC degranulation response from both MC lines (Fig. 2A). The magnitude of the MC responses was dependent on the concentration of platelets in the conditioned medium and the duration of time that the platelets were activated (Fig. 2A). To further define the nature of the platelet factor(s), we ultracentrifugated the conditioned medium after platelet activation and observed that MC-stimulating activity was contained in the supernatant and not in the microparticle pellet. Furthermore, the soluble portion obtained from freeze-thawed resting platelets (to release their cellular content without activation) only marginally activated MCs, suggesting that the MC-activating factor(s) was not stored in significant quantities as a preformed mediator. Together, these in vitro observations suggest that MC activation is not dependent on direct contact and that soluble factors formed after platelet activation can directly trigger MC degranulation.

(A) Isolated platelets were activated for indicated periods (5, 15, and 30 min) and at indicated concentrations (1 107, 5 106, 2.5 106, and 1 106 platelets/ml) with thrombin (or convulxin where indicated). Two MC lines [ROSA (R) and LAD2 (L)] were then exposed to cell-free supernatant from this reaction and MC degranulation measured by tryptase activity assay. In addition, supernatant from activated platelets was ultracentrifuged, and the pelletresuspended in Tyrodes buffer (MP, microparticle pellet)or the supernatant (MPS, microparticle supernatant) was added to MCs. Last, resting platelets (1 107) were freeze-thawed and centrifuged, and debris-free supernatant was tested on MCs (Rest F/T). T, Tyrodes buffer; I, ionomycin positive control; R, resting platelet supernatant. (B) For biochemical characterization of MC-activating effect, LAD2 cells were exposed to supernatant from activated platelets without further treatment (AP), after boiling for 30 min (APb), incubation on activated charcoal (APc), or following isolation of lipid fraction (AP-l). T-l, lipid fraction from Tyrodes buffer; R-I, lipid fraction from resting platelet supernatant. (C) LAD2 cells were pretreated with antagonists against various lipid mediators [BAY-u 3405 (10 M): Bay; L798,106 (100 nM): L798; Ex26 (10 M): Ex; AH 6809 (10 M): AH; montelukast (100 M): Mo; WEB2086 (0.1 to 100 M): Web] before exposure to heat-treated activated-platelet supernatant. Purified PAF was added at 0.1 to 10 M. Degranulation was measured using -hexosaminidase assay. NS, not significant. (D) Quantitative determination of PAF in supernatants from resting and activated platelets and activated platelet supernatant absorbed with activated charcoal. Data are represented as the means SD. *P < 0.05 versus resting platelet supernatant and #P < 0.05 versus respective activated platelet supernatant, one-way ANOVA and Tukeys multiple comparisons test. All data derived from four independent experiments were performed in triplicate wells. PRP, platelet-rich plasma.

We next sought to determine the identity of the MC-activating factor(s) in the platelet-conditioned medium. Notably, boiling of the platelet supernatant did not reduce MC-activating activity, whereas absorption with activated charcoal abrogated it, suggesting that the active component was a lipid compound (Fig. 2B). We confirmed this by preparing a lipid extract of the conditioned medium and observed that MC-activating activity was largely contained in this extract. Since platelets are already known to produce several prominent bioactive lipid mediators, we undertook a screening experiment of possible MC-activating candidates. Using antagonists to leukotriene receptors (montelukast: 1 to 100 nM), the prostaglandin EP1/EP2 receptor (AH 6809: 1 to 100 M), the EP3 receptor (L-798,1016: 1 to 100 nM), the dual thromboxane TP/prostaglandin DP2 receptor (BAY-u 3405: 0.1 to 10 M), or the shingosine-1-phosphate receptor 1 (Ex-26: 1 to 100 M) before exposure to the activated platelet-conditioned medium, we observed no appreciable decline in MC activation (Fig. 2C). However, when we pretreated MCs with WEB2086, an inhibitor of the platelet activating factor (PAF) receptor, we observed a dose-dependent inhibition of MC activation. To verify that PAF is the active factor in the platelet-conditioned medium, we conducted liquid chromatographymass spectrometry (LC-MS) lipid quantification of the medium and found that platelet activation caused the release of significant amounts of PAF C16 and C18 (Fig. 2D). Consistent with the functional properties of PAF, absorption of platelet medium with activated charcoal significantly reduced PAF levels. Last, we exposed MCs to increasing doses of purified PAF and observed dose-dependent MC degranulation (Fig. 2C and fig. S2). Together, our data indicate that PAF is the predominant platelet product responsible for MC degranulation.

These findings led us to question whether platelet-derived PAF can directly act on MCs, which are found on the apposing side of the endothelium. We therefore applied PAF at concentrations shown previously to cause MC activation to the apical side of human umbilical vein endothelium cells (HUVECs) grown on semipermeable supports. Starting from a transendothelial resistance (TEER) of 146.9 22.7 ohmcm2, we observed that PAF itself significantly but transiently disrupted endothelial integrity. However, when PAF was added to HUVECs in the presence of human MCs (ROSA) in the basal compartment of the Transwell system, the drop in TEER did not reverse during the experiment (Fig. 3A). At the same time, we observed that these basal MCs degranulated after addition of apical PAF and that the extent of degranulation was comparable to that when PAF was added to Transwell inserts without a HUVEC cell layer (Fig. 3B). Together, these results suggest that intravascular PAF can act on perivascular MCs and that this contact is made possible likely by a collaborative effort of PAF and MC products on endothelial barrier tightness. Moreover, endothelial cells do not appear to directly participate in the signaling events.

(A) HUVEC cells were grown to confluency on permeable supports, and then 1 106 ROSA cells were added to some of the basal compartments (ROSA HUVEC) followed by addition of PAF at 1 or 10 M or vehicle control to the apical compartment. TEER was measured for 1 hour. *P < 0.05 versus untreated ROSA/HUVEC cocultures by two-way ANOVA. (B) -Hexosaminidase from supernatants of HUVEC endothelial cells, ROSA MC cells, and cocultured HUVEC/ROSA cells with or without addition of PAF (at 1 or 10 M) to the apical side of the endothelia. n = 8 per condition. Results shown as average SD, *P < 0.05 versus untreated ROSA/HUVEC cocultures.

In view of our in vitro results, we now sought to determine whether the platelet-mediated MC activation in vivo was dependent on PAF. We therefore first examined the systemic response to collagen and epinephrine injection after pretreatment with the PAF inhibitor WEB2086. Although we noticed a marked blunting of the shock response, it was not totally abolished (Fig. 4A), and thus, we could not readily infer that this response was fully PAF-mediated. A possible explanation for this finding is that collagen and epinephrine injections cause systemic thrombosis and thus evoke temperature changes independent of inflammatory reactions. Therefore, we next examined a second, distinct model of systemic platelet activation (16). This model achieves platelet activation with a monoclonal antibody against mouse integrin IIb (clone MWReg30), which causes thrombocytopenia within a few minutes (Fig. 4, B and C). We found that platelet activation in this manner also resulted in a sharp drop in core body temperature, which was abrogated in mice pretreated with WEB2086, indicating that it was PAF dependent (Fig. 4D). We further confirmed that this severe inflammatory response was platelet dependent by showing that depletion of platelets in these mice before MWReg30 antibody administration protected from shock. Further support for the notion that the shock response following platelet activation was PAF dependent was provided by the finding that phospholipase A2 knockout (Pla2-KO) mice, which display a significantly reduced PAF production (17), failed to succumb to shock. Similarly, deficiency of PAF sensing, as observed in PAF receptor knockout (Pafr-KO) mice (18), also protected from shock following MWReg30 antibody administration (Fig. 4D). In agreement, injection of purified PAF was sufficient to cause shock in wild-type (WT) and Pla2-KO mice but not in Pafr-KO mice (Fig. 4E). Together, in vivo platelet activation and systemic release of platelet-derived PAF results in shock.

(A) Temperature measurement following intravenous administration of collagen and epinephrine with (CollE WEB) or without (CollE) pretreatment with the PAF inhibitor WEB2086; control animals received intravenous phosphate-buffered saline (PBS). Administration of antiintegrin aIIb (MWReg30) antibody caused significant thrombocytopenia [representative anti-glycoprotein IX (GPIX) stain versus forward scatter (FSC) before (B) and after (C) treatment]. (D) Temperature measurement following intravenous administration of MWReg30 in untreated mice (WT), in WEB2086-pretreated (WT-WEB) and platelet-depleted (WT-PLT deplete) mice, and in phospholipase A2(Pla2-KO) and PAF receptor(Pafr-KO) knockout animals. (E) Temperature measurement after administration of purified PAF (2 mg/g bodyweight) in WT, Pla2, or Pafr-knockout (Pafr-KO) mice. Adoptive platelet transfer was performed in hIL-4R/GPIbtransgenic mice. These were platelet-depleted through administration of antiIL-4R antibody (F) and repleted with platelets from either Pla2-KO or WT mice (G) before administration of MWReg30 (H). Fluorescence-activated cell sorting (FACS) data are shown as anti-GPIX stain versus forward scatter and is representative of experimental findings. Systemic response to MWReg30 was measured as change in body temperature (I) and by quantification of plasma levels of MC-specific chymase (J) and TNF (K). Data are represented as the means SD. n = 4 to 6 per condition. *P < 0.05 versus control-treated animals and #P <0.05 versus respective stimulated WT or WT-repleted animals. (A, B, and G) Two-way ANOVA; (H and I) one-way ANOVA and Tukeys multiple comparisons test.

Because PAF is released by various immune cells into the circulation (19), we sought to verify that it is indeed platelet-secreted PAF that causes MC activation and shock in vivo. For this, we used an adoptive transfer model where platelets were infused into human interleukin-4 receptor alpha/platelet glycoprotein Ib (hIL-4R/GPIb) transgenic mice whose endogenous platelets had been depleted by administration of antiIL-4R antibody as described previously (20). This allowed repletion with platelets from either WT or Pla2-KO mice that lack the ability to generate PAF (17). We then administered MWReg30 antibody to activate platelets in both of these repleted groups and examined the mice for MC activation and shock. Here, the exposure of the WT-platelet reconstituted mice to MWReg30 elicited an overall blunted systemic response compared to our previous experiments, likely due to the reduced platelet numbers achieved after reconstitution (Fig. 4, F to H). However, this response was altogether absent in mice reconstituted with Pla2-KO platelets (Fig. 4I). Furthermore, only mice reconstituted with WT platelets displayed increases in plasma-chymase and plasmatumor necrosis factor (TNF) levels, which are indicators of MC activation (Fig. 4, J and K). These results support that the PAF responsible for MC activation and shock following administration of MWReg30 antibody is specifically platelet derived.

Since shock as indicted previously is a characteristic inflammatory response linked to MCs, we aimed to further define the specific role of MCs in the propagation of PAF-mediated platelet responses. We compared MWReg30 antibodyinduced shock responses in WT and MC-deficient Sash mice and in Mcpt5-cre+iDTR+ mice depleted of MCs (21). We found that whereas MC-competent mice evoked a significant shock response to MWReg30 administration, both groups of MC-deficient mice experienced blunted shock response (Fig. 5A). Since shock is preceded by vascular leakage, another well-known MC-mediated inflammatory response, we compared vascular leakage in WT and MC-deficient mice following MWReg30 administration. We found that WT mice experienced severe vascular leakage but not MC-deficient or MC-depleted mice (Fig. 5, B to E). Last, products of activated perivascular MCs can also significantly affect the organ they are proximal to. To demonstrate the potential of PAF-activated MCs to affect surrounding tissue responses, we examined expression of inflammatory genes in the intestines of MC-deficient Sash mice reconstituted with bone marrowderived MCs (BMMCs) from WT or Pafr-KO mice following administration of MWReg30. BMMC injection into Sash mice does not reconstitute tissue MC uniformly but achieves good reconstitution in the intestines (22). For comparison, we also included MC-deficient Sash mice that were not reconstituted in this assay. As shown in Fig. 5F, animals reconstituted with WT BMMC, but not unreconstituted mice or mice reconstituted with BMMCs from Pafr-KO animals, demonstrated a significant increase in tissue inflammatory gene expression in intestinal samples, suggesting that PAFR (PAF receptor)competent MCs are necessary for platelets to promote tissue inflammation. Thus, platelet-induced MC degranulation serves to amplify platelet-initiated inflammatory signals and translate these into tissue responses.

(A) Temperature measurement following intravenous administration of MWReg30 in WT mice and in MC-deficient KitW-sh/W-sh (Sash) or MC-depleted Mcpt5-cre + iDTR + (Mcpt-DTR) mice. n = 6 per condition. *P < 0.05 versus MWReg30-treated WT, two-way ANOVA. (B) Extravasation of Evans blue after intravenous administration of MWReg30 in control or MC-depleted Mcpt-DTR mice. OD, optical density. n = 5 per condition. *P < 0.05 versus unchallenged WT; #P < 0.05 versus MWReg30-treated WT, one-way ANOVA and Tukeys multiple comparisons test. Immunofluorescence in whole-mount tissue (ear) in animals administered 150 kDa of TRITC-dextran intravenously before MWReg30 administration [blue, endothelium (anti-CD31); green, MCs (fluorescein isothiocyanateavidin)] shows tracer extravasation (arrows) in WT mice (C and D) but not in Sash mice (E). (F) Transcriptional analysis of small intestinal tissue expression of inflammatory markers in Sash mice or in Sash mice reconstituted with Pafr-KO (Pafr-KO reconstituted) or WT (WT reconstituted) bone marrowderived MCs and treated with MWReg30. Data are represented as the means SD. n = 4 to 6 per condition. *P < 0.05 versus nonreconstituted and #P < 0.05 versus WT-reconstituted animals. One-way ANOVA and Tukeys multiple comparisons test.

In view of the potential for platelets to trigger MC-mediated inflammatory responses, we investigated the consequences of blocking platelet activation in the rat DHCA model, and specifically the impact of such platelet inhibition on subsequent MC activation. Because of the close correlation between the site of tissue damage and deposition of aggregated platelets during DHCA, we first sought to map the major sites of platelet deposition following this procedure. For these studies, we isolated platelets from donor rats and labeled them with NIR78 (23), a near-infrared label, and then intravenously administered these cells immediately after completion of the CPB. After 2 hours of recovery, the major organs of the rats were harvested and imaged for platelet deposition. We found that a major deposition site of platelets following DHCA was the intestines (Fig. 6A). This observation supports our earlier finding indicating preferential deposition in the intestines as a primary site of tissue damage following DHCA (8). As confirmed by immunofluorescence using a platelet-specific marker, imaging revealed platelet deposition also in the kidneys (fig. S3). However, as reported previously, we found no histological (8) or biochemical (urine neutrophil gelatinase-associated lipocalin) (fig. S3) evidence of renal injury at this time point. Kidneys feature a similar susceptibility to hypoxia as the gut (24) but contain very few MC in their parenchyme (25).

In vivo platelet labeling documents significant tissue platelet retention in vehicle-pretreated animals (A) but not in clopidogrel-pretreated animals (B) or in sham animals (C). Organs are identified in (C): stomach (S), colon (Co), caecum (Cae), brain (B), lungs (L), kidney (K), and liver (Li). (D) Platelet count before and after CPB in clopidogrel-pretreated (gray lines) or vehicle-pretreated (black lines) animals. To account for dilutional effects during extracorporeal circulation, data are presented as the ratio of platelet over red blood cell (RBC) count. #P < 0.05 versus DHCA-Vh, by unpaired Students t test of delta baseline values. Each line represents one animal. Representative images of the macroscopic intestinal phenotype in vehicle-pretreated (E) and in clopidogrel-pretreated animals (F). (G) Microscopic injury score in sham and DHCA-treated vehicle control (DHCA-Vh) or clopidogrel-pretreated (DHCA-Clop) animals. (H) Plasma PAF and (I) plasma chymase levels (normalized to plasma protein to adjust for on-bypass dilution effects) at baseline (T0), after CPB (T1), and after a 2-hour recovery period (T2). (J) Plasma TNF levels after a 2-hour recovery period. Data are represented as the means SD. n = 4 per condition and n = 3 for sham. *P < 0.05 versus sham and #P < 0.05 versus DHCA-Vh, one-way ANOVA and Tukeys multiple comparisons test. Plasma PAF (K) and chymase (L) levels were determined by ELISA in patients undergoing cardiac surgery with DHCA. Samples were collected after induction of anesthesia (baseline: pre) or after completion of CPB perfusion (post-CPB). To account for dilution effects, values are normalized for plasma protein content. (M) Platelet counts were obtained from medical records at time of baseline or post-CPB blood draw and normalized to hemoglobin (Hb) concentration to account for perioperative blood loss and dilution. n = 20, values shown with median, *P < 0.01 by Wilcoxon signed-rank test. Photo credit: Jrn Karhausen, Duke University.

We found that when we pretreated animals with clopidogrel, a potent P2Y12 inhibitor that has been extensively studied in systemic conditions involving platelet activation (26), we could completely block platelet deposition in the intestines and other sites after DHCA (Fig. 6B and fig. S3). Consistent with this finding, rats pretreated with clopidogrel maintained their platelet count throughout the experiment, whereas in control animals, we observed a drop in platelet numbers after completing CPB (Fig. 6D). Furthermore, clopidogrel pretreatment significantly reduced intestinal pathology compared to vehicle-treated DHCA mice as evidenced by both macroscopic (Fig. 6, E and F) and microscopic (Fig. 6G) examination. Plasma PAF levels, which displayed a sharp rise after DHCA in control animals, did not change significantly in the clopidogrel-treated group (Fig. 6H). Supporting the notion that abrogation of platelet activation also blocks MC activation, we observed limited levels of circulating chymase and TNF levels in the clopidogrel-treated rats compared to controls (Fig. 6, I and J). Thus, during modeled DHCA, platelet activation and aggregation are critical preceding events to MC activation and the severe inflammation and tissue injury in the intestines. To provide clinical support to our findings, we measured PAF- and MC-specific chymase in 20 consecutive patients undergoing DHCA for repair of proximal aortic pathologies. Consistent with our findings in the rat model, we observed a significant increase of plasma PAF {median baseline (plasma protein), 0.154 ng/g [interquartile range (IQR), 0.138 to 0.169 ng/g] versus post-CPB, 0.213 ng/g (IQR, 0.174 to 0.236 ng/g); P < 0.01; Fig. 6K} and chymase levels [baseline (plasma protein), 1.038 pg/g (IQR, 0.502 to 2.085 pg/g) versus post-CPB, 6.322 pg/g (IQR, 3.630 to 8.929 pg/g); P < 0.01; Fig. 6L]. During the same period, platelet numbers significantly decreased relative to the hemoglobin (Hb) concentration [baseline, 1344.5 platelets/mg Hb (IQR, 1226.2 to 1482.4 platelets/mg Hb) versus post-CPB, 1045.6 platelets/mg Hb (IQR, 855.3 to 1251.0 platelets/mg Hb); P < 0.01], which suggests that the drop in platelet numbers was not due to bleeding or dilution but potentially due to concurrent platelet activation (Fig. 6M). These observations document that our experimental data align with events observed in patients undergoing comparable procedures.

Rapid activation of multiple, powerful inflammatory pathways during and after cardiac surgery has been identified as a key to the ongoing, high incidence of end-organ injury associated with these procedures. To elucidate the critical factors that shape decisions of tissue inflammation and injury in this setting, we focused on early events, reasoning that by limiting our studies to this window, we would identify mediators that are initiators of the inflammatory cascade and prime candidates for therapeutic intervention. This approach revealed a critical role of MCs and linked MC activation to early tissue injury and inflammation in a rat model (8) and to intraoperative hypotension in cardiac surgical patients (9). However, a major obstacle to further develop the therapeutic potential of MC modulation is that it currently remains unclear how MCs are activated in this setting. Therefore, we further examined the injury phenotype of the intestine as a primary site of tissue injury and MC activation in the setting of extracorporeal circulation (8, 27) and found significant platelet deposition on the luminal sides of small blood vessels. This microvascular placement positions platelets in close proximity to perivascular MCs, and indeed, our ensuing work demonstrated that platelets, through release of the lipid mediator PAF, actively triggered MC activation and thus caused shock, vascular leakage, and tissue inflammation. Hence, our results outline a powerful, previously undefined mechanism of inflammatory augmentation by establishing the collaboration of two cell types that have, relatively recently, come into focus as important immune sentinel cellsplatelets within the intravascular compartment (6) and MCs at the tissue/microvascular interface (10).

What determines the preferential platelet deposition in the gut in our model is unclear, but evidence exists demonstrating that changes of splanchnic blood flow during nonpulsatile CPB result in substantial intestinal hypoperfusion [reviewed in (24)]. In agreement, we and others had shown intestinal I/R injury and intestinal MC activation to be the earliest signs of end-organ injury in rat and porcine models of extracorporeal circulation (8, 27). Following I/R, endothelial cell surfaces undergo significant changes, resulting in the rapid and sustained adherence of platelets to postcapillary venules upon reperfusion (5). Consequently, it is likely that the particularly hypoperfusion-prone intestinal vasculature provides a unique locale that facilitates the inflammatory collaboration between platelets and perivascular MCs thus making the gut a hotspot for the generation of inflammatory mediators in conditions such as cardiac surgery.

Platelets are increasingly appreciated as central immune regulatory cells that directly interact with both endothelium and intravascular immune cells and perform multifaceted inflammatory functions such as regulating neutrophil recruitment, extracellular trap formation, or cytokine release [reviewed in (6)]. In our work, the close spatial relationship between platelet aggregates and perivascular MCs on apposing sides of the vasculature raised the possibility that activated platelets release bioactive agents that traverse the endothelium to stimulate MC degranulation. Consequently, through a series of fractionation studies and biochemical assays, we established that platelets can activate MCs through secretion of PAF, a potent proinflammatory phospholipid implicated in various pathological reactions including anaphylaxis (28). PAF is released by various cells of the host defense system with neutrophils, basophils, endothelial cells, and MCs previously identified as major producers (19). Consistent with our results, platelet-dependent release of PAF has been described (29), but the relative contribution of platelets to overall PAF levels and whether PAF from other sources (e.g., endothelia) contributes to platelet-triggered responses remain to be further defined.

Consistent with our findings, PAF is not stored in the preformed state but rather is rapidly synthesized in response to cell-specific stimuli by remodeling of cellular phosphatidylcholine (30). Receptor-induced activation of the key enzyme, cytosolic phospholipase A2 (PLA2), is crucial for the acute lipid membrane remodeling during platelet activation and not only constitutes the first step in generating lipid mediators such as PAF but also provides important substrates required to support the energetic demands during platelet activation (31). PLA2 functions are not exclusive to PAF metabolism and Pla2-knockout (Pla2-KO) mice appear to have abnormalities, e.g., in thromboxane A2 synthesis (32). However, our studies involving the specific PAF antagonist WEB2086 and chimeric mice, in which we reconstituted platelet-depleted mice with platelets lacking PLA2 and therefore PAF production, strongly suggest that platelet-derived PAF causes MC activation. Conversely, we also provide evidence on the specific role of MC sensing of such platelet-derived PAF by use of MC-deficient and MC-depleted animals as well as of MC-deficient animals repleted with Pla2-knockout (Pla2-KO) BMMC. Together, these experiments support our notion that platelet-derived PAF triggers MC activation. Although the bioavailability of PAF in the circulation is very limited (33), it is conceivable that platelets create a protective microenvironment where PAF, because of its lipid nature, is able to traverse the endothelial walls and reach MCs. Consistent with reported evidence (34), we showed that platelet-derived PAF significantly alters endothelial barrier integrity and can thus act on MCs on the apposing side of the endothelium. In vivo, such contact may further be facilitated by the fact that MCs appear to form protrusions across the endothelial cell layer to directly survey intravascular events (35).

MC differentiation is highly tissue specific, and PAF receptors have been found in lung MCs and peripheral bloodderived but not skin MCs (36). Therefore, while our work demonstrates that a platelet-specific stimulus can cause release of PAF and resultant perivascular MC activation, these responses may vary in different tissues depending on the receptor equipment of local MC populations. In addition, MCs are not only sensors of PAF but also an important source of this mediator. During anaphylaxis, high levels of PAF are detected (28), and it is believed that hematogenous dissemination of this agent may be pivotal for rapid systemic MC activation after localized allergen exposure (36). This highlights that similarly following platelet-triggered MC activation, MC-autocrine production of PAF (37), as well as of further powerful mediators, may be instrumental in spreading and magnifying an initially limited response.

While our work identifies MC stimulation through platelet-derived PAF as an important, previously unknown proinflammatory mechanism, a limitation of our study is that it remains difficult to ascertain its relative contribution in complex conditions such as cardiac surgery. As highlighted by the work of Cloutier et al. (38) and, more recently, of Mauler et al. (39), PAF-independent mechanisms exist by which platelets trigger systemic responses. These mechanisms appear to have overlapping and distinct effects, e.g., platelet serotonin release after FcRIIA receptor activation (38) caused vasodilatation and shock but not vascular leakage as observed in our anti-gpIIb/IIIa model. Furthermore, systemic responses in our model were independent of serotonin effects, as previously shown (16) and as documented by the fact that shock was fully prevented by pretreatment with a PAF receptor antagonist, or in Pafr- and Pla2-KO mice. However, we did not test the role of serotonin in systemic responses in the rat model and cannot exclude that, in this more complex preclinical model, multiple platelet-dependent mechanisms contributed.

Last, our finding that platelet activation following rat DHCA is responsible for much of the subsequent early pathology suggests that targeting platelet-dependent inflammatory responses may be an effective strategy to reduce morbidity and mortality. Platelet activation is not routinely determined but has been inferred from the drop in platelet count often observed after cardiac surgery. The possibility that such thrombocytopenia occurs in the context of increased platelet reactivity has been suggested by its association with blood clot formation leading to stroke (40). A drop in platelet count is associated with inflammatory derangements in various conditions including cardiac surgery (4). Evidence from our rat DHCA model that the platelet antagonist clopidogrel stopped microvascular platelet deposition, prevented the associated drop in platelet count, and reduced MC-mediated inflammatory and tissue injurious responses thus is of significant translational interest. Hence, our data add important mechanistic insights to clinical observations, suggesting beneficial effects from controlling the platelet contribution to tissue injury and systemic inflammatory derangements in cardiac surgery (41). However, an inherent problem with these approaches is both the variable pharmacodynamic efficacy of commonly used antiplatelet agents and the fact that, especially in the perioperative setting, more potent inhibitors pose a substantial bleeding risk. As suggested by our data using a MC inhibitor in modeled DHCA (8), targeting downstream events, such as MC activation, may be a safer approach to improve outcomes.

All procedures performed for this study were approved by the Animal Care and Use Committee of Duke University and the University of North Carolina, Chapel Hill, respectively, and conformed to National Institutes of Health guidelines for animal care.

Adult male Sprague-Dawley rats (436.5 34 g, 10 to 12 weeks old) underwent deep hypothermic arrest in association with CPB (referred to in this paper as DHCA for simplicity) as described previously (8). For imaging purposes, animals were transitioned to an alfalfa-free diet (LabDiet, St. Louis, MO) 7 days before the start of the experiment and were randomized to receive two oral doses of either clopidogrel (3 mg/kg bodyweight) (MilliporeSigma, Burlington, MA) or normal saline 12 hours before and immediately after induction of anesthesia.

Anesthesia was induced with isoflurane (2 to 2.5 volume %), and animals were intubated and mechanically ventilated (45% O2/balance N2 and 35 to 45 mmHg of PaCO2). The tail artery and right external jugular vein were then cannulated, and 150 IU of heparin and 5 g of fentanyl were administered. Physiologic measurements, including mean arterial pressure, pericranial and rectal temperature, and blood gases [adjusted to the measured temperature (pH strategy) and maintaining 31 to 40 mmHg of PaCO2], were recorded (table S1). After initiation of CPB, animals were cooled for 30 min, and at a pericranial temperature of 16 to 18C, the bypass machine was stopped for a circulatory arrest period of 45 min. CPB was then reinitiated for rewarming and stopped at a pericranial temperature of 35.5C. Animals recovered under anesthesia for 2 hours until euthanasia.

For platelet labeling, we modified the technique of Flaumenhaft et al. (23) using two donor rats per experimental animal, which were pretreated as the experimental animal, i.e., with clopidogrel or vehicle. Donors were anesthetized with isoflurane, and whole blood in a volume of approximately 10% of the total donor blood volume was removed. Platelets were then isolated by centrifugation in the presence of apyrase (0.2 U/ml) and prostaglandin E1 (1 M) (MilliporeSigma) throughout. The targeted platelet count was approximately 1.8 108. Platelets were washed in Tyrodes buffer and labeled with 2 M IR-786 (H.W. Sands Corp., Jupiter, FL) for 30 min at 37C. After additional washing, these platelets were brought up in phosphate-buffered saline (PBS), and an aliquot was tested by fluorescence-activated cell sorting (FACS) to verify absence of surface expression of the platelet activation marker CD62P. Labeled platelets were transfused to recipient rats at the time point of reperfusion after circulatory arrest.

For imaging and tissue harvest, animals were euthanized by isoflurane overdose and perfused with 200 ml of PBS to wash out circulating platelets. Organs were removed, and tissue retention of labeled platelets was visualized using the IVIS Kinetic in vivo imaging system (Caliper Life Sciences, Hopkinton, MA) by setting the excitation to 795 to 815 nm and absorption to 760 to 780 nm.

Six- to 8-week-old mice were used for our experiments. Mcpt5-cre+iDTR+ mice were from A. Roers, University of Technology, Dresden (21). In these mice, MCs were conditionally depleted through intravenous injections of 200 ng of diphtheria toxin per mouse every other day for 2 weeks (13). Pla2/ (17) and Pafr/ (18) mice were provided by Shimizu (University of Tokyo) through the RIKEN BioResource Research Center (RBRC01733 and RBRC05641) and were rederived by the Division of Laboratory Animal Resources, Duke University Medical Center. In addition, the following strains were used: C57BL/6, KitW-sh/W-sh, and Mcpt5-Cre tdTomatofl/fl (42).

Systemic platelet activation was induced in two ways. First, we used a systemic mouse thrombosis model with collagen and epinephrine as platelet stimulants. Second, we examined the systemic response elicited by a monoclonal antibody that targets platelet integrin IIb receptor as previously published (16). Following anesthesia with isoflurane, animals received either 0.275 g collagen/g bodyweight (MilliporeSigma) together with 1.2 g of epinephrine (MilliporeSigma) in 200 l of PBS or 3 g/g bodyweight of the antiintegrin IIb receptor antibody clone MWReg30 (BioLegend, San Diego, CA). Animals were then recovered at room temperature, and the rectal temperature was measured in regular intervals.

Mice (hIL-4R/GPIbTg) (43) were rendered thrombocytopenic by retro-orbital injection of antihIL-4R (2.5 g/g body weight, clone 25463; R&D Systems, Minneapolis, MN). Platelet depletion was verified 16 hours after antibody injection by flow cytometry analysis (Accuri C6, BD Biosciences, Franklin Lakes, NJ) of whole blood stained with Alexa Fluor 647labeled antibodies against glycoprotein IX (GPIX) (2 g/ml; R&D Systems). Platelet repletion was performed as previously published (20). In short, blood was drawn into heparinized tubes from the retro-orbital plexus of sedated Pla2-KO or WT animals (7.7 l/g body weight). Platelets were purified by successive centrifugation at 100g for 5 min (to obtain platelet-rich plasma) and at 700g in the presence of PGI2 (2 g/ml) for 5 min at room temperature. Pelleted platelets were resuspended in modified Tyrodes buffer [137 mM NaCl, 0.3 mM Na2HPO4, 2 mM KCl, 12 mM NaHCO3, 5 mM N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid, and 5 mM glucose (pH 7.3)]. Platelets from several donor mice were pooled, and the platelet count was adjusted to 5 109 platelets/ml in 100 l of Tyrodes buffer for transfusion. Posttransfusion platelet counts were determined by flow cytometry 30 min after injecting platelets before MWReg30 administration.

BMMCs were obtained from bone marrow of WT and Pafr/ mice and cultured for 8 to 12 weeks as previously described (13). For repletion, 1 107 BMMCs were injected intravenously into KitW-sh/W-sh mice and allowed to mature in the tissues for another 8 weeks.

Whole blood (40 ml) was collected in acid-citrate-dextrose sodium citrate (1:9, v/v) from healthy individuals under a protocol approved by the Institutional Review Board for Human Subject Research at Duke University and centrifuged at 120g for 8 min. To prevent platelet activation, 1 M prostaglandin E1 and apyrase (0.2 U/ml) (MilliporeSigma) were added to the platelet-rich plasma and at each of the following steps. Platelets were obtained by centrifugation at 650g for 8 min, washed in buffer containing 36 mM citric acid, 5 mM glucose, 5 mM KCl, 1 mM MgCl2, 103 mM NaCl, 2 mM CaCl2, bovine serum albumin (3.5 g/liter), and resuspended in standard Tyrodes buffer. Platelet activation was performed with either thrombin (0.2 U/ml), collagen (10 g/ml), type I solution from rat tail (both MilliporeSigma), or convulxin (0.3 ng/ml) (Cayman Chemical, Ann Arbor, MI). To verify platelet activation, a platelet aliquot was fixed in 4% formalin for each condition, washed in PBS, and stained with an antiCD62-allophycocyanin antibody (BD Biosciences) and analyzed on a FACSCalibur flow cytometer. Isotype controltreated samples were used for comparison (BD Biosciences). The remaining sample was centrifuged to obtain cell-free conditioned media. In a subset of experiments, this supernatant was further processed by incubating on activated charcoal (MilliporeSigma), boiling for 30 min, or ultracentrifugating for 30 min at 20,000g to isolate microparticles. Lipid extraction was performed using the method of Bligh and Dyer (44). In brief, the platelet supernatant was mixed with chloroform-methanol (2:1, v/v), and then successively, chloroform and water were added before centrifugation at 1000 rpm for 5 min. The lower phase was then carefully harvested, dried under airflow, and resolubilized in Tyrodes buffer.

PAFs were extracted and analyzed by LC-MS essentially as described earlier with minor modifications (45). Briefly, the samples were extracted for PAF by methyl tert-butyl ether, and the extracts were fractionated using aminopropyl silica to isolate the PAF fraction. The PAFs coelute with lysophosphatidylcholine in this method. They were resolved by high-performance liquid chromatography using a Luna C18(2) column (2 150 mm, 3 ; Phenomenex) before detecting by LCtandem MS with unique multiple reaction monitoring combinations as described (45). PAFs were quantified by internal standard quantitation method using PAF C16-d4 as the internal standard added to the sample before processing.

The human MC lines ROSA (14) were provided by M. Arock (Laboratoire de Biologie et Pharmacologie Applique, CNRS) and LAD2 (15) by A. S. Kirshenbaum (National Institutes of Health). The ROSA cells were maintained in Iscoves modified Dulbeccos medium (Invitrogen, Carlsbad, CA) and LAD2 cells in StemPro-34 (Invitrogen) supplemented with recombinant human stem cell factor (100 ng/ml), penicillin and streptomycin (100 U/ml), and 1 GlutaMAX (ThermoFisher, Waltham, MA). MC degranulation was examined by measuring the activity either of tryptase using a commercially available kit (MilliporeSigma) or of -hexosaminidase as published. In both cases, results were calculated as the percent activity in supernatant versus activity in cell lysate. The following agonists and antagonists were tested at concentrations indicated in Results: WEB2086, montelukast, AH 6809, BAY-u 3405, L798.106, and Ex26 (all Tocris, Bristol, UK); PAF C16 and pertussis toxin (both MilliporeSigma). For IgE-antigen activation, LAD2 cells were passively sensitized by incubating with biotinylated human IgE for 16 hours. Sensitized LAD2 cells were stimulated with different doses of streptavidin as indicated for 1 hour. Supernatant was collected and analyzed for -hexosaminidase activity. To determine viability, LAD2 cells were treated with indicated concentrations of PAF for 1 hour, and reduction of MTS tetrazolium compound was measured according to the manufacturers instructions. Results were calculated as % viable cells.

HUVECs were maintained as described (46). For experiments, 1 105 cells were seeded on 0.4-m polyethylene permeable supports (Corning Life Sciences, Tewksbury, MA) and left to adhere until TEER reached approximately 120 ohmcm2, and then medium was exchanged to Tyrodes buffer. The basal compartment of the Transwell system was loaded with either buffer or 1 106 ROSA cells, and TEER was recorded before and during 1 hour after addition of 0, 1, or 10 M PAF to the apical surface of the HUVECs. Degranulation of basal ROSA cells was determined at the end of the experiment by -hexosaminidase assay.

RNA was isolated (Macherey-Nagel, Bethlehem, PA) from snap-frozen tissue. After deoxyribonuclease digestion and reverse transcription (Bio-Rad, Hercules, CA), quantitative polymerase chain reaction (PCR) was performed on a CFX96 Real-Time PCR Detection System (Bio-Rad), with -actin (NM_007393; F: cccaacttgatgtatgaagg and R: tttgtgtaaggtaaggtgtgc) serving as internal standard. The following primers were used and amplified at 60C: Cxcl2 (NM_009140.2; F: cagactccagccacacttca and R: ttcagggtcaaggcaaactt), Tnfa (NM_013693; F: ctgaacttcggggtgatcgg and R: ggcttgtcactcgaattttga), Il6 (NM_031168; F: gatggatgctaccaaactgga and R: tgaaggactctggctttgtct), and Il1b (NM_008361.3; F: tgtaatgaaagacggcacacc and R: tcttctttgggtattgcttgg).

Plasma samples were analyzed by enzyme-linked immunosorbent assay (ELISA) using rat chymase (LifeSpan Biosciences, Seattle, WA), rat TNF, mouse MC protease 1, mouse TNF (all ThermoFisher), and PAF (Lifeome BioLabs, Oceanside, CA) ELISA kits. To account for dilution during bypass, rat samples were normalized to each samples protein level (DC Protein Assay, Bio-Rad).

For whole-mount staining, the inner parts of the ear skin were peeled away from the intervening cartilage and fixed for 1 hour in 1% paraformaldehyde. Ear skin segments were then washed, permeabilized, and blocked in a solution containing 10% donkey serum, 0.3% Triton X, and 1% bovine serum albumin in PBS. Then tissue was incubated with anti-CD31 (BD Biosciences) and anti-CD41 (Novus Biologicals, Centennial, CO) antibody overnight, washed, and stained with fluorescent-labeled secondary antibody (Jackson ImmunoResearch, West Grove, PA) for 2 hours at room temperature. MC granules were visualized with tetramethyl rhodamine isothiocyanate (TRITC)avidin (MilliporeSigma). Samples were mounted with ProLong antifade with 4,6-diamidino-2-phenylindole as counterstain (ThermoFisher).

Embedded tissue sections were deparaffinized, and heat-mediated antigen retrieval was performed in sodium citrate buffer. After blocking at room temperature, sections were labeled with antibodies targeting CD41 and E-cadherin (Invitrogen), and binding was visualized with fluorescent-labeled secondary antibody.

To examine vascular permeability, mice were injected with 200 l of dextran-TRITC (10 mg/ml) (150 kDa; MilliporeSigma) at the time of platelet activation (13). After 90 min, animals were euthanized, and whole mounts were prepared and processed as outlined above. In vivo vascular leakage was quantified using the Evans blue dye extravasation technique (13). Briefly, Evans blue (20 mg/kg; MilliporeSigma) was injected intravenously 60 min before euthanasia. Tissue was then harvested, air-dried, weighed, and incubated in tissue formamide (25 l/mg) at 55C for 48 hours. The absorption of extracted Evans blue was then measured at 610 nm.

Hematoxylin and eosinstained sections from formalin-fixed and paraffin-embedded tissue samples were scored by independent observers blinded to treatment modalities according to the method of Chiu et al. (47).

Plasma samples were obtained in the course of an ongoing, Institutional Review Boardapproved clinical study investigating effects of temperature on cognitive function after DHCA procedures for repair of ascending aortic arch pathologies (ClinicalTrials.gov identifier: NCT02834065). Plasma samples from 20 consecutively enrolled patients after induction of anesthesia (baseline) and following completion of the circulatory arrest and CPB period were retrieved and analyzed by ELISA for PAF (Cusabio, Houston, TX) and chymase levels (Cloud Clone Corp., Wuhan, China). Platelet count at corresponding times was obtained from clinical records. Because CPB entails significant blood dilution, measurements were normalized either to plasma protein content (for ELISAs, determined by RC DC Protein Assay, Bio-Rad) or to hemoglobin concentration (for platelet count, from patient electronic records with corresponding time stamp).

Statistical analyses were performed using GraphPad Prism v.8 (GraphPad Software). Unpaired Students t test, two-way analysis of variance (ANOVA), and one-way ANOVA with Tukeys multiple comparisons tests were used to calculate statistical significance. P < 0.05 was considered statistically significant. Measured values of PAF, chymase, and platelet count in patients were compared with baseline values using Wilcoxon signed-rank test. Experimental data are presented as median SD. Patient data are shown as median (IQR).

Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/12/eaay6314/DC1

Fig. S1. Platelet deposition following rat DHCA model occurs in tissues that are particularly sensitive to I/R injury.

Fig. S2. EC50 and LD50 of PAF on cultured MCs.

Fig. S3. Clopidogrel prevents tissue platelet retention after DHCA.

Table S1. Physiologic variables during rat DHCA.

Movie S1. Platelets aggregate in close proximity to perivascular MCs after activation with collagen and epinephrine.

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.

Acknowledgments: We thank J. Fowler for technical assistance. Funding: This work was funded by U.S. National Institutes of Health grants 1R56HL126891-01 to J.K.; 1R35 HL144976-01 to W.B.; R01-AI096305, R56-DK095198, and U01-AI082107 to S.N.A.; T32HL007149 to R.H.L.; and 1R01HL130443 to J.K. and J.P.M. Further support came from National Center for Research Resources, National Institutes of Health grant S10RR027926 to K.R.M., the American Heart Association grant 15SDG25080046 to J.K., and a Duke Clinical and Translational Science Institute grant (UL1TR002553) to J.K. Author contributions: J.K., W.B., and S.N.A. were involved with conceptualization, development of methodology, and preparation of original draft and reviewing and editing of the manuscript. J.K., H.W.C., Q.M., Y.B., R.H.L., and J.P.M. performed the investigation. K.R.M. performed methodology development and analyses. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read the original post:
Platelets trigger perivascular mast cell degranulation to cause inflammatory responses and tissue injury - Science Advances

Upside For Flexion Therapeutics Depends On How Well It Can Commercialize ZILRETTA In 2020 – Seeking Alpha

Flexion Therapeutics (NASDAQ:FLXN) presented its Q3 quarterly update on March 12, 2020 (As we tracked on our catalyst calendar on Ampbioresearch.com). Therefore, we took an updated look at the company as we decided whether to change our FLXN positions in our portfolios ahead of the quarterly call. This article is not intended to be a general review of FLXN. For such a review you can visit the company's web site, including its more recent corporate slide deck. You can also visit the ZILRETTA/knee osteoarthritis (OA) pain page on Ampbioresearch.com for information on ZILRETTA for knee OA, including a list of ZILRETTA publications with links.

In our view, for FLXN at this point, it comes down to how well the company commercializes ZILRETTA in the osteoarthritis knee pain market. ZILRETTA is a long-acting extended release therapy that was first approved by the FDA in October 2017 for the treatment of knee pain associated with osteoarthritis. An sNDA (updated label) was approved for ZILRETTA late last year related to repeat administration. With over 6 million steroid injections annually to treat pain associated with osteoarthritis of the knee, the market opportunity for ZILRETTA is very large. Whether FLXN can tap into enough of this large market to drive strong share price gains remains to be seen. In this article, we attempt to identify the reasons that FLXN ZILRETTA sales may be flattening out and what could drive share increase in the future.

FLXN's stock price is primarily driven by revenue and clinical performance of ZILRETTA. Therefore, we were excited in mid-2019 about FLXN when sales of ZILRETTA showed good quarterly growth (See graph below). Unfortunately, sales appeared to flatten in the second half of the year. The quarterly revenue growth rates were 60% in Q2, 28% in Q3, and 9% in Q4 by our calculations. Furthermore, FLXN management guided to flat sales in Q1 '20 vs. Q4 '19, which should be considered in view of first quarter revenue being flat or down for biopharma sales in many cases, for various reasons including consumers' reluctance to spend in Q1 when they will pay out of pocket deductibles. FLXN management boasts about its 2019 vs. 2018 revenue growth and points out that hyaluronic acid injection sales are typically down 10% in first quarters annually.

Source:(Amp Bioresearch FLXN ZILRETTA Page)

The question for investors is whether this apparent revenue plateau justifies the current fairly low stock price, or whether the projected 2020 revenue growth and/or the large market potential, provides a FLXN stock price growth opportunity in 2020 and beyond. The company has guided for 2020 ZILRETTA revenue of between $120 and $135 million, which would be between 65% and 85% year over year growth from the $73M of 2019, which was 220% higher than 2018. However, using the Q4 run rate of about $24 million, this would be annual growth of between 25% and 41%, compared to a 36% annual growth rate using 4X the Q3 to Q4 2019 growth. Thus, the company predicts continued growth similar to or slightly less than the Q3/Q4 rate, which arguably has not impressed the market given stock market performance, likely because of ZILRETTA's current relatively small revenue base for a therapeutic. FLXN's stock performance in 2020 thus far seems consistent with this viewpoint and the more recent macro downward pressures. In this article, we try to determine whether there is upside in FLXN's guidance and stock performance for 2020 and beyond.

Let's start with the opportunity. The market for pain injections for osteoarthritis is large. FLXN cites IQVIA data (see slide below) that indicates that the market is around 5M insured U.S. patients per year. Furthermore, the data FLXN presents indicates that 4.5M of these patients receive steroid injections for a total of around 7 million steroid injections per year. At $300/injection wholesale price (assumed to be about of $600 current cost to end user, see below), that total market opportunity appears to be in the billions for ZILRETTA, and even more if one uses FLXN's report that a WAC of $570 is justified (See FLXN March 2020 Corp slide deck slide 19).

Source - FLXN March 2020 corporate slide deck

Furthermore, diabetics with OA of the knee is a significant market. A recent CDC publication indicates that 17 percent of Americans between 45 and 64 years of age, and 25 percent of Americans 65 years and older have diabetes. FLXN's CEO on the recent Raymond James investor call indicated that about 20% of OA knee patients are diabetics. Therefore, if we use FLXN's numbers of around 7M steroid injections per year, around 1.4 million of those are for diabetics. At $300 wholesale per ZILRETTA injection, that's a submarket of over $400M, and almost twice that if we use the wholesale price (i.e. WAC) that FLXN indicates is supported.

With this large market opportunity, why has FLXN not been able to capture, and guide to even more market adoption of ZILRETTA in the knee OA pain market? A number of reasons have been discussed on investor calls. One issue for ZILRETTA is competition from generic steroid injections and other choices for injections for knee OA pain. There are a growing number of options for injections to treat joint pain such as hyaluronic acid (HA), platelet-rich plasma (PRP), and placental tissue matrix (PTM) (Cleveland Clinic). We are not aware of a head-to-head trial of ZILRETTA with any of these other injectables. However, a recent review article (Bisicchia and Tudisco, Clin Cases Miner Bone Metab. 2017 May-Aug; 14(2): 182-185) that analyzed prior primary and meta-analysis of a number of hyaluronic acid (HA) trials, concluded as follows: "Conflicting results have been reported in clinical studies and meta-analysis on the efficacy and safety of HA. Guidelines are controversial and "uncertain" recommendations are provided in most of the cases due to inconclusive evidence in literature. However, HA does not seem to have significantly higher side effects when compared to saline or CSs injections, and provides better medium-term control of symptoms in patients with mild to moderate knee osteoarthritis. More studies are needed to better clarify the controversies on this topic, along with a homogeneous methodology in study design, and collection, analysis, and interpretation of data."

Thus, at least from these authors, HA may only be marginally better than immediate release corticosteroids (CSs). In fact, the 2013 Guidelines of the American Academy of Orthopaedic Surgeons noted that published studies showed a statistically significant but not clinically effective response to HA injections, and do not recommend using HA injections to treat knee pain (Guidelines). What about PRP? According to "Your Guide to Injections for Knee Osteoarthritis" on everydayhealth.com, there is not enough evidence to show a benefit of PRP over HA. However, there are peer-reviewed publications such as Guvendi et al (2018), that conclude that there is a long-term benefit of PRP over CSs, although there are limitations to this study, (e.g. it was not a blinded study). Kavadar et al. published another study that showed long-term benefit of PRP, although the benefit appeared better with multiple injections, but there was no placebo control group in this study (Kavadar et al. 2015).

We do intend to provide a thorough scientific review of data on options for injections to treat knee pain. However, from what we found, CS appears to still be the first choice in OA knee pain injections, but HA and PRP are competitive options. The authors of the HA review cited above call CSs the "gold standard" for injection into a joint to relieve pain because it is well established over decades for having short-term pain benefits. The Cleveland Clinic page on injections for joint pain cited above call CSs "the first line of defense." And this 2013 article looking at cost/benefit of different knee treatment options, confirmed steroid injections as the standard of care. Furthermore, it appears to be common to give the same patient a CS injection plus other pain injections at later times (See e.g. everydayhealth.com article cited above). Therefore, steroid injection still appears to be a well-accepted initial injection for the treatment of pain associated with OA of the knee. However, there is likely strong competition when it comes to marketing a therapy like ZILRETTA, an extended release CS, for better long-term efficacy compared to immediate release CS. Thus, one factor affecting ZILRETTA's adoption is likely competing therapies that provide benefits over immediate release steroids. Nevertheless, if FLXN's sales force can convince orthopedic MDs that ZILRETTA has enough advantages over immediate release CS and the economics of using ZILRETTA make sense for their practice, it still seems possible that a significant portion of this large market could be available with ZILRETTA as a replacement for immediate release CSs, especially if orthopedics felt that other options such as PRP could be used if pain returns after 1 or multiple ZILRETTA injections.

The ZILRETTA efficacy data in the label shows separation from immediate release steroids for a single administration.

Source: ZILRETTA label (package insert)

It is unfortunate that we don't see more separation in efficacy over time in the ZILRETTA arm of the study in the label to further substantiate its extended release formulation. However, FLXN sales reps can provide orthopedics with several ZILRETTA publications that provide more convincing data of the benefits of ZILRETTA over immediate release CSs. For example, the Conaghan et al. JB&JS 2018 publication of the phase 3 results, which shows statistically significant improvements across pain, stiffness, physical function, and quality of life for 4, 8 and 12 week time points (See Table IV from that publication below).

Source: Conaghan et al. JB&JS 2018 publication of the phase 3 results

Furthermore, data on these endpoints is even more convincing on a post-hoc analysis done on the subset of patients in the phase 3 study participants with unilateral knee OA (Langworthy et al.). Thus, it appears that there is substantial data that the FLXN sales team can use to show that ZILRETTA provides superior efficacy to immediate release CSs to try to convince orthopedics that ZILRETTA should be used instead of immediate release CSs as a first injection therapy.

Another issue for FLXN with respect to its inability to grab more market share is the fact that ZILRETTA's first approved indication was only for a single administration. Steroid injections are often re-administered to a patient, and FLXN felt their sales force was at a disadvantage with the initial label that was limited to single administration. Fortunately, in Q4 2019 the FDA approved FLXN's sNDA for an updated label for repeated use of ZILRETTA. However, the approved label language doesn't seem that convincing for repeat use. Here is FLXN's press release, which notes the change in intended use language as follows:

"Removal of language which stated that ZILRETTA was "not intended for repeat administration." The updated label states that the "efficacy and safety of repeat administration of ZILRETTA have not been demonstrated." "

Here's the actual label, intended use section:

Source: ZILRETTA label (package insert)

Furthermore, the safety language on the label for repeat administration doesn't look that helpful either

Source: ZILRETTA label (package insert)

The CEO of FLXN clarified at the recent Raymond James Investors Conference that he feels it is now a much better situation for his sales team post sNDA approval, since they can present to, and specifically discuss the publication of the results from their repeat administration publication with potential prescribers. Prior to the expanded label approval, they could not discuss the repeat administration results with prescribers, but only refer them to the FLXN scientific affairs team if they had questions. Therefore, hopefully the FLXN sales force can use the repeat administration publication to drive more sales. With respect to repeat administration, ZILRETTA appears to be effective on a second administration 12 to 24 weeks after an initial administration based on FLXN's repeat administration trial results. Although efficacy appears to decrease slightly upon a second administration of ZILRETTA, the data still looks very convincing that ZILRETTA remains very active on a second administration (see graph below from Spitzer et al. Rheumatology and Therapy 2019). Thus, FLXN may be able to convince orthopedics to use ZILRETTA initially instead of immediate release CS, and repeat ZILRETTA administration at 3-5 months to get more relief, and then if the pain returns, potentially switch to another type of injection such as PRP or opt for knee replacement surgery.

Source: Spitzer et al. Rheumatology and Therapy 2019

It appears that repeat administration efficacy data is strong enough to confirm that ZILRETTA is effective on a second administration. The questions are whether the data is strong enough to change prescribing habits and compete with alternative long-term pain relief options, and overcome possible practice economics issues (see below) to drive substantially more sales of ZILRETTA.

Another advantage of ZILRETTA is that it is particularly well differentiated over immediate release CSs for diabetics who receive a CS injection in a painful OA knee to reduce pain. An immediate release CS injection in the knee brings a spike in glucose. This spike is significantly reduced when ZILRETTA is used instead of immediate release CS (See slide below).

Source - FLXN March 2020 corporate slide deck and FIG. 2 of Russell et al. 2018.

It is noteworthy that despite the title of that slide from FLXN, that graph is not in the label. We believe FLXN is referring to the following statement in the ZILRETTA label:

Despite the minimal coverage for diabetics in the ZILRETTA label from our viewpoint, FLXN's commercial team should be able to leverage the published data for diabetic patients to drive more sales in this subsegment of the market. For example, ZILRETTA showed an increase of glucose of 155.24 before administration to 163.41 post-administration, which was significantly less than the increase seen with immediate release CS of 161.71 to 198.78 (See FIG. 3 of Russell et al. 2018). With respect to the diabetic market however, in the recent Raymond Jones call, the FLXN CEO was quick to point out that the company did not want to pigeon hole the market for ZILRETTA into diabetic patients.

Another reason that has been brought up on investor calls that potentially is holding back more rapid and extensive market adoption is that the cost and reimbursement situation for ZILRETTA is not attractive for providers such as orthopedic practices and/or hospitals. This is not an area where we have deep understanding and in general actual net revenue per injection information is not publicly available, but as far as we can tell this might be a key issue holding back ZILRETTA adoption. The retail price of ZILRETTA as best we can tell appears to be around $600 (Drugs.com, Oklahoma Health Care Authority 2018 (Packet Contents for DUR Board Packet - January 9, 2019) annual review of ZILRETTA (pg. 93) (download available at http://www.okhca.org), and webmd.com), which appears consistent with the $604 average selling price we find in CMS's reimbursement table effective January 1, 2020 based on ZILRETTA's Jcode (J3304) (See FLXN corp deck slide 20) ($18.88 per mg and an administration of ZILRETTA is 32 mg), which FLXN indicates is about 104% of the ASP (FLXN March 2020 corporate slide deck). This price seems similar to the price of HA (Brett 2016 Editorial) or PRP injections (Everyday Health). The average retail price we find for Kenalog-40 an immediate release triamcinolone, the CS in ZILRETTA, is about $12.00 (See e.g. Oklahoma Health link above and drugs.com). For a person paying out of pocket, this almost $600 difference may not be worth the increased efficacy and even safety if they are a diabetic. Even for a payor, this difference might require a special situation, such as diabetes (See Oklahoma Health link page 93, "A patient-specific, clinically significant reason why the member cannot use Kenalog-40... must be provided").

Since these knee pain injections are administered by providers at their outpatient facilities and many of the patients receiving injections are on private insurance or Medicaid, the situation is more complex. FLXN has reported good commercial insurance coverage and that Medicaid will reimburse providers, since there is a J code and ZILRETTA is delivered on label and for an indication that is medically necessary and reasonable (See FLXN March 2020 corporate slides 1-21). The more specific issue might be in the amount that providers such as orthopedic practices and hospitals are reimbursed, especially for Medicaid patients, compared to what they are paying for ZILRETTA, and how that compares to their reimbursement and cost for immediate release CSs. Plus, payors, such as the Oklahoma Health Care Authority, may be reluctant to pay such a high price premium without special circumstances, such as diabetes as noted above.

FLXN appears to acknowledge that there is an issue(s) that they need to overcome to reach the full market potential for ZILRETTA. The CEO indicated on that same Raymond James call that they still want to hire a Chief Commercial Officer (CCO) who can help FLXN figure out how to significantly increase its market share. In fact, FLXN announced the hiring of a new CCO this week. Thus, either FLXN doesn't understand the reason that there is not more market adoption, or understands the reason(s) but doesn't know how to fix it. Until we see some quarterly revenue that shows a more significant increase than current guidance, we do not predict that FLXN will exceed its guidance for 2020 and find it difficult to predict revenue in future years without seeing 2020's actual revenue numbers.

The vast majority of the value of FLXN currently, resides in ZILRETTA. However, FLXN has some other assets as well (See our ampbioresearch.com Corporate profile database slide below), but they are much earlier phase assets. Furthermore, FLXN has some mid-late stage ZILRETTA trials, for example to expand the label into shoulder OA pain (see below).

Source: (Ampbioresearch.com FLXN corporate database page)

If FLXN's commercial team can have success tapping into the OA pain market for ZILRETTA, it does not take a detailed valuation to see that FLXN's valuation and stock price can increase substantially over its current ~$250M market cap and enterprise value of roughly $300M (about $190M debt and about $135M cash). If one uses even a 5X revenue multiplier, a fairly conservative multiplier for a biopharmaceutical company, and FLXN is able to reach its $120M low end guidance this year, there appears to be upside in the stock price given the recent market correction. In the coming few years if FLXN can achieve $200M in sales, that would warrant a $1B market cap. Of course, there are a lot of factors that go into the revenue multiple in a stock price and increased revenue growth and apparent maximum revenue compared to cost of goods, R&D expenses supporting revenue growth, and especially the selling portion of SG&A expense would dictate FLXN valuation on a long-term basis. If FLXN could find a way to tap into much more of this large knee OA market, based on increased revenue and an increased multiplier because of an increased growth rate, it is not hard to get to double its current valuation and stock price. By our calculations using a rough free cash flow model (data not shown), it also appears that FLXN is undervalued currently, given its recent significant stock price drop, if it can hit its 2020 projections despite the pandemic.

Using Q4 2019 numbers, FLXN had about $135M cash/equivalents/securities and a burn rate of about $35M/quarter. Thus, FLXN ended Q4, 2019 with about 1 year of cash and a growing revenue stream that could decrease the burn rate depending on 2020 expense management. Although on their most recent call, FLXN management again noted that they projected that they would not need to raise more cash before they became profitable, this seems unlikely under the current 2020 revenue guidance and quarterly spend especially as they indicated an increasing R&D spend this year. However, it does not appear that a dilution event is imminent at this time, but probably will occur later in 2020.

In sum, we currently hold a low percent position in FLXN in a number of our funds, and will continue to monitor FLXN closely. The macro pandemic news has really hit FLXN hard the past week, which has quickly created a valuation opportunity when the markets return to normal. We are interested in the readout in their ongoing OA shoulder pain phase 2 trial of ZILRETTA, but that is not scheduled to read out until the first half of 2021. However, we are most interested to see if FLXN, especially with a new Chief Commercial Officer, can find a way to more significantly and rapidly increase its market share in this large market opportunity, or execute on the 2020 guidance and convince the market that peak sales of ~$400 million within 10 years is achievable despite the challenges of a highly competitive marketplace. Given the recent correction based on the macro downturn from the pandemic, at its current market cap, FLXN appears undervalued. Furthermore, although we do not invest hoping for an acquisition, it would be a nice surprise for shareholders if an entity with an effective commercial team in the pain/orthopedic space is willing to pay a premium on the current depressed FLXN stock price based on the commercial potential of ZILRETTA. Thus, we will continue to closely monitor FLXN's commercial and clinical progress in 2020.

Quick Note: Thanks for taking the time to read our article - hope it was helpful and useful. If it was beneficial to you in any way please consider hitting that 'follow' button to stay updated of our future analysis. Also wanted to note that these articles, including a version that we published before the FLXN quarterly report-out, are available in advance to our free community over at Ampbioresearch.com, including educational videos and more. If you have any questions or comments we would love to hear them!

Disclosure: I am/we are long FLXN. I wrote this article myself, and it expresses my own opinions. I am not receiving compensation for it. I have no business relationship with any company whose stock is mentioned in this article.

Read the original:
Upside For Flexion Therapeutics Depends On How Well It Can Commercialize ZILRETTA In 2020 - Seeking Alpha