Category Archives: Embryonic Stem Cells

Turning Back the Clock on Aging Cells – The New York Times

Researchers at Stanford University report that they can rejuvenate human cells by reprogramming them back to a youthful state. They hope that the technique will help in the treatment of diseases, such as osteoarthritis and muscle wasting, that are caused by the aging of tissue cells.

A major cause of aging is thought to be the errors that accumulate in the epigenome, the system of proteins that packages the DNA and controls access to its genes. The Stanford team, led by Tapash Jay Sarkar, Dr. Thomas A. Rando and Vittorio Sebastiano, say their method, designed to reverse these errors and walk back the cells to their youthful state, does indeed restore the cells vigor and eliminate signs of aging.

In their report, published on Tuesday in Nature Communications, they described their technique as a significant step toward the goal of reversing cellular aging and could produce therapies for aging and aging-related diseases.

Leonard P. Guarente, an expert on aging at M.I.T., said the method was one of the most promising areas of aging research but that it would take a long time to develop drugs based on RNA, the required chemical.

The Stanford approach utilizes powerful agents known as Yamanaka factors, which reprogram a cells epigenome to its time zero, or embryonic state.

Embryonic cells, derived from the fertilized egg, can develop into any of the specialized cell types of the body. Their fate, whether to become a skin or eye or liver cell, is determined by chemical groups, or marks, that are tagged on to their epigenome.

In each type of cell, these marks make accessible only the genes that the cell type needs, while locking down all other genes in the DNAs. The pattern of marks thus establishes each cells identity.

As the cell ages, it accumulates errors in the marking system, which degrade the cells efficiency at switching on and off the genes needed for its operations.

In 2006 Dr. Shinya Yamanaka, a stem-cell researcher at Kyoto University, amazed biologists by showing that a cells fate could be reversed with a set of four transcription factors agents that activate genes that he had identified. A cell dosed with the Yamanaka factors erases the marks on the epigenome, so the cell loses its identity and reverts to the embryonic state. Erroneous marks gathered during aging are also lost in the process, restoring the cell to its state of youth. Dr. Yamanaka shared the 2012 Nobel Prize in medicine for the work.

But the Yamanaka factors are no simple panacea. Applied to whole mice, the factors made cells lose their functions and primed them for rapid growth, usually cancerous; the mice all died.

In 2016, Juan Carlos Izpisua Belmonte, of the Salk Institute for Biological Studies in San Diego, found that the two effects of the Yamanaka factors erasing cell identity and reversing aging could be separated, with a lower dose securing just age reversal. But he achieved this by genetically engineering mice, a technique not usable in people.

In their paper on Tuesday, the Stanford team described a feasible way to deliver Yamanaka factors to cells taken from patients, by dosing cells kept in cultures with small amounts of the factors.

If dosed for a short enough time, the team reported, the cells retained their identity but returned to a youthful state, as judged by several measures of cell vigor.

Dr. Sebastiano said the Yamanaka factors appeared to operate in two stages, as if they were raising the epigenomes energy to one level, at which the marks of aging were lost, and then to a higher level at which cell identity was erased.

The Stanford team extracted aged cartilage cells from patients with osteoarthritis and found that after a low dosage of Yamanaka factors the cells no longer secreted the inflammatory factors that provoke the disease. The team also found that human muscle stem cells, which are impaired in a muscle-wasting disease, could be restored to youth. Members of the Stanford team have formed a company, Turn Biotechnologies, to develop therapies for osteoarthritis and other diseases.

The study is definitively a step forward in the goal of reversing cellular aging, Dr. Izpisua Belmonte said.

Follow this link:
Turning Back the Clock on Aging Cells - The New York Times

A New Way to Study HIV’s Impact on the Brain – Global Health News Wire

By culturing astrocytes, microglia, and neuronsall derived from human-induced pluripotent stem cellsin one dish, researchers have created an effective model to study the cognitive impacts of HIV and other diseases. (Image: Sean Ryan)

Though many negative repercussions of human immunodeficiency virus infection can be mitigated with the use of antiretroviral therapy (ART), one area where medical advances havent made as much progress is in the reduction of cognitive impacts. Half of HIV patients have HIV-associated neurocognitive disorders (HAND), which can manifest in a variety of ways, from forgetfulness and confusion to behavior changes and motor deficiencies.

To better understand the mechanisms underlying HAND, researchers from Penns School of Dental Medicine and Perelman School of Medicine and from the Childrens Hospital of Philadelphia (CHOP) brought together their complementary expertise to create a laboratory model system using three of the types of brain cells thought to be involved. Led by doctoral student Sean Ryan, who was co-mentored by Kelly Jordan-Sciutto of Penn Dental Medicine and Stewart Anderson of CHOP and Penn Medicine, the model recapitulates important features of how HIV infection and ART affect the brain.

Frankly the models we generally use in the HIV field have a lot of weaknesses, says Jordan-Sciutto, co-corresponding author on the paper, which appears in the journalStem Cell Reports. The power of this system is it allows us to look at the interaction between different cell types of human origin in a way that is more relevant to patients than other models.

In addition to studying HIV, members of the team plan to use the same model to shed light on the neurological mechanisms that underlie other conditions, such as schizophrenia, Alzheimers, and even normal aging.

Were collaborating with a variety of colleagues to use this system to study Alzheimers disease as well as schizophrenia, says Anderson, co-corresponding author on the paper. We have the components in a dish that we know are interacting in these diseases, and this gives us a new mix-and-match way to understand how certain cells are contributing to neuronal damage.

Indeed, the impetus to create the model grew not out of HIV research but work that Ryan was pursuing in Andersons lab on schizophrenia.

We had been looking at the role of microglia, the resident immune cells of the central nervous system, says Ryan, first author on the work. We wanted to see if we could see the mechanistic changes that occur with microglia in schizophrenia.

To do so, Ryan and Anderson were interested in using human-induced pluripotent stem cellsadult cells that are reprogrammed to resemble embryonic stem cellswhich can be coaxed into differentiating into a variety of different cell types.

But schizophrenia is a complicated disease with a variety of contributing genetic and environmental factors and a broad spectrum of presentations. Rather than looking at something complex, they sought to apply their new system to a disease that likewise causes neurological damage but does so in a more dramatic way and in which microglia are also implicated: HIV/AIDS infection.

They reached out to Jordan-Sciutto, who has deep experience investigating the mechanisms of HAND and was eager for the opportunity to develop a model superior to those currently available. Together, the scientists identified the three cell types they were most interested in studying: neurons, astrocytes, and microglia.

Neurons arent directly infected by HIV but are known to be damaged during infection. Meanwhile astrocytes are believed to interact with neurons, causing damage by sending pro-inflammatory factors into the spaces between cells, called synapses. And microglia, which are responsible for maintaining a healthy environment in the absence of disease, are seen to expand and contribute to inflammation during HIV infection.

After nailing the technical challenge of creating this tractable model in which each cell type is generated independently and then mixed together, the team used it to probe how HIV infection and ART impact the cells, both alone and in combination.

A lot of people are taking PreEP [pre-exposure prophylaxis] if theyre in a situation where their risk of contracting HIV is heightened, says Ryan. Just as we want to understand the cognitive impacts of HIV, we also want to see whether these drugs alone are impacting the brain health of otherwise healthy people.

The researchers looked at RNA expression in their cultures to get a sense of what proteins and signaling pathways were becoming activated in each scenario. During infection, they saw inflammatory pathways that had previously been implicated in HIV in earlier research. When they introduced the antiretroviral drug EFZ, which is not in common use in the United States but remains a frontline therapy in many other areas of the world, with an infection, the activity of most of these pathways was reduced.

But this scenario involved its own unique response, says Ryan. Certain pathways associated with inflammation and damage remained despite the introduction of EFZ.

EFZ treatment of the tri-cultures that included HIV-infected microglia reduces inflammation by around 70%, Ryan says. Interestingly, EFZ by itself also triggered inflammation, though to a lesser extent than infection.

It seems a combination of infection and ART is creating its own unique response that is different from the sum of its parts, Ryan says. Knowing what pathways are still active due to ART could help us appropriately target additional therapies so patients dont develop HAND.

Many features of infection seen in the three-cell culture mirror what is known from HIV infection and ART treatment in people, giving the researchers confidence in the reliability of their model.

Just looking at the microglia, says Anderson, we see in our system that they are taking on both of their normal roles in keeping key signaling systems balanced during their normal state and activating and causing damage when theyre fighting infection. Were able to model normality and abnormality in a way we havent been able to before.

For Jordan-Sciutto, the new system is really going to change the way my lab operates going into the future. Shes hopeful many other HIV scientists will take it up to further their studies as she also explores more aspects of HIVs impact on the brain, such as how it navigates through the blood-brain barrier that normally protects the central nervous system from inflammation and infection.

The study authors give credit to the collaborative environment at Penn for this cross-disciplinary project. Tentacles of this project extend from CHOP to the dental school to the vet school to the medical school, says Anderson. Penn is a very special place where people seem to be more likely to share their technologies around and let other people work with and develop them. This project is a great example of that.

Read the rest here:
A New Way to Study HIV's Impact on the Brain - Global Health News Wire

Human Embryonic Stem Cell Market Analysis and Forecasts to 2027 By Recent Trends, Developments In Manufacturing Technology And Regional Growth…

An off-the-shelf report onHuman Embryonic Stem Cell Marketwhich has been compiled after an in-depth analysis of the market trends prevailing across five geographies (North America, Europe, Asia-Pacific, Middle-East and Africa, and South America). Various segments of the market such as type/components/ application/industry verticals/ end-users are analyzed with robust research methodology which includes three step process starting with extensive secondary research to gather data from company profiles, global/regional associations, trade journals, technical white papers, paid databases etc. followed by primary research (interviews) with industry experts/KOLs to gain their insights and views on current scenarios and future scope of the market as well as validating the secondary information, further internal statistical model is used to estimate the market size and forecasts till 2027.

Get sample PDF copy at:https://www.theinsightpartners.com/sample/TIPRE00005165/

The human embryonic stem cells are obtained from the undifferentiated inner mass cell of the human embryo and human fetal tissue. The human embryonic stem cell can replicate indefinitely and produce non-regenerative tissue such as myocardial and neural cells. This potential of human embryonic stem cell allows them to provide an unlimited amount of tissue for transplantation therapies to treat a wide range of degenerative diseases. Hence, human embryonic stem cells are used in the treatment of various diseases such as Alzheimers disease, cancer, blood and genetic disorders related to the immune system and others.

The key players influencing the market are:

This report contains:

The global human embryonic stem cell market is segmented on the basis of product type, application and end user. Based on product type, the market is segmented as totipotent stem cell, pluripotent stem cell and unipotent stem cell. On the basis of application, the global human embryonic stem cell market is segmented into regenerative medicine, stem cell biology research, tissue engineering and toxicology testing. Based on end users, the market is segmented as therapeutics companies, cell & tissue banks, tools & reagents companies and others.

Human Embryonic Stem Cell Market- Global Analysis to 2027 is an expert compiled study which provides a holistic view of the market covering current trends and future scope with respect to product/service, the report also covers competitive analysis to understand the presence of key vendors in the companies by analyzing their product/services, key financial facts, details SWOT analysis and key development in last three years. Further chapter such as industry landscape and competitive landscape provides the reader with recent company level insights covering mergers and acquisitions, joint ventures, collaborations, new product developments/strategies taking place across the ecosystem. The chapters also evaluate the key vendors by mapping all the relevant products and services to exhibit the ranking/ position of top 5 key vendors.

Human Embryonic Stem Cell Market is a combination of qualitative as well as quantitative analysis which can be broken down into 40% and 60% respectively. Market estimation and forecasts are presented in the report for the overall global market from 2018 2027, considering 2018 as the base year and 2018 2027 forecast period. Global estimation is further broken down by segments and geographies such as North America, Europe, Asia-Pacific, Middle East & Africa and South America covering major 16 countries across the mentioned regions. The qualitative contents for geographical analysis will cover market trends in each region and country which includes highlights of the key players operating in the respective region/country, PEST analysis of each region which includes political, economic, social and technological factors influencing the growth of the market.

Key Benefits

Purchase This Report @https://www.theinsightpartners.com/buy/TIPRE00005165/

About Us:The Insight Partners is a one stop industry research provider of actionable intelligence. We help our clients in getting solutions to their research requirements through our syndicated and consulting research services. We are a specialist in Technology, Semiconductors, Healthcare, Manufacturing, Automotive and Defense.

Contact Us:Call: +1-646-491-9876Email:[emailprotected]

Read the original here:
Human Embryonic Stem Cell Market Analysis and Forecasts to 2027 By Recent Trends, Developments In Manufacturing Technology And Regional Growth...

Laboratory model looking at how a HIV infection impacts the brain – Health Europa

The Human Immunodeficiency Virus (HIV) infection impacts the human body in a variety of ways, however medical advances have made progress in mitigating the impact of the infection using antiretroviral therapy (ART). One area of impact which is yet to see much progress is the impact of the infection on cognition.

Half of HIV patients have HIV-associated neurocognitive disorders (HAND), which can manifest in a variety of ways, from forgetfulness and confusion to behaviour changes and motor deficiencies.

To better understand the mechanisms underlying HAND, researchers from Penns School of Dental Medicine and Perelman School of Medicine and from the Childrens Hospital of Philadelphia (CHOP) brought together their complementary expertise to create a laboratory model system using three of the types of brain cells thought to be involved.

Led by doctoral student Sean Ryan, who was co-mentored by Kelly Jordan-Sciutto of Penn Dental Medicine and Stewart Anderson of CHOP and Penn Medicine, the model recapitulates important features of how HIV infection and ART affect the brain.

The research was published in the journal Stem Cell Reports.

Jordan-Sciutto, co-corresponding author on the paper, said: Frankly the models we generally use in the HIV field have a lot of weaknesses. The power of this system is that it allows us to look at the interaction between different cell types of human origin in a way that is more relevant to patients than other models.

Anderson, co-corresponding author on the paper, said: Were collaborating with a variety of colleagues to use this system to study Alzheimers disease as well as schizophrenia.

We have the components in a dish that we know are interacting in these diseases, and this gives us a new mix-and-match way to understand how certain cells are contributing to neuronal damage.

We had been looking at the role of microglia, the resident immune cells of the central nervous system, says Ryan. We wanted to see if we could see the mechanistic changes that occur with microglia in schizophrenia.

Ryan and Anderson were interested in using human-induced pluripotent stem cells, which are adult cells that are reprogrammed to resemble embryonic stem cells, and which can be coaxed into differentiating into a variety of different cell types.

The scientists identified the three cell types they were most interested in studying: neurons, astrocytes, and microglia.

Neurons arent directly infected by HIV but are known to be damaged during infection. Meanwhile astrocytes are believed to interact with neurons, causing damage by sending pro-inflammatory factors into the spaces between cells, called synapses. Microglia, which are responsible for maintaining a healthy environment in the absence of disease, are seen to expand and contribute to inflammation during HIV infection.

A lot of people are taking PreEP [pre-exposure prophylaxis] if theyre in a situation where their risk of contracting HIV is heightened, says Ryan. Just as we want to understand the cognitive impacts of HIV, we also want to see whether these drugs alone are impacting the brain health of otherwise healthy people.

The researchers looked at RNA expression in their cultures to see what proteins and signalling pathways were becoming activated in each scenario. During infection, they saw inflammatory pathways that had previously been implicated in HIV in earlier research. When they introduced the antiretroviral drug EFZ, which is not in common use in the United States but remains a frontline therapy in many other areas of the world, with an infection, the activity of most of these pathways was reduced.

Ryan said: EFZ treatment of the tri-cultures that included HIV-infected microglia reduces inflammation by around 70%.

It seems a combination of infection and ART is creating its own unique response that is different from the sum of its parts. Knowing what pathways are still active due to ART could help us appropriately target additional therapies so patients dont develop HAND.

Many features of infection seen in the three-cell culture mirror what is known from HIV infection and ART treatment in people, giving the researchers confidence in the reliability of their model.

Just looking at the microglia, says Anderson, we see in our system that they are taking on both of their normal roles in keeping key signalling systems balanced during their normal state and activating and causing damage when theyre fighting infection. Were able to model normality and abnormality in a way we havent been able to before.

For Jordan-Sciutto, the new system is really going to change the way my lab operates going into the future.

She is hopeful many other HIV scientists will take it up to further their studies as she also explores more aspects of HIVs impact on the brain, such as how it navigates through the blood-brain barrier that normally protects the central nervous system from inflammation and infection.

In addition to studying HIV, members of the team plan to use the same model to shed light on the neurological mechanisms that underlie other conditions, such as schizophrenia, Alzheimers, and even normal ageing.

See original here:
Laboratory model looking at how a HIV infection impacts the brain - Health Europa

Cell Banking Outsourcing Market With Economic Growth And Five Forces Analysis By 2021 – Lake Shore Gazette

A cell bank refers to a facility that store cells derived from various body fluids and organ tissue for future needs. The bank store the cells with detailed characterization of the cell line hence decrease the chances of cross contamination. Cell banking outsourcing industry involves collection, storage, characterization, and testing of cells, cell lines, and tissues. Cell banks provide cells, cell lines, and tissues for R&D, production of biopharmaceuticals with maximum effectiveness and minimal adverse events. The process for storage of cells includes first proliferation of cells that multiplied in large number of identical cells and then stored into cryovials for future use. Cells mainly used in the regenerative medicine production. Increasing demand of stem cell therapies and number of cell banks expected to boost the global market.

Global cell banking outsourcing market segmented based on bank type, cell type, phase, and geography. Based on bank type market is further segmented into master cell banking, working cell banking, and viral cell banking. Cell type segment further divided based on stem cell banking and non-stem cell banking. Stem cell banking includes dental, adult, cord, embryonic, and IPS stem cell banking.

For detailed insights on enhancing your product footprint, request for a Sample here @https://www.persistencemarketresearch.com/samples/8026

Based on phase, the global cell banking outsourcing market segmented into preparation, storage, testing, and characterization. Geographically, market divided into North America, Europe, Asia Pacific, Latin America, and Middle East Africa. By considering bank type master cell banking accounted largest share owing to longer duration of preservation that would attract the researcher. Stem cell banking accounted larger share than non-stem cell banking due to lower risk of contamination.

In stem cell banking cord stem cell banking accounted larger share by revenue in 2014 due to increasing number of cord blood banks, and services globally. Additionally, donor convenience, immediate availability, lower risk of viral contamination is major driving factors for cord stem cell banking. In bank phase, segment storage phase accounted largest share and expected to maintain its share due to development of sophisticated preservation technologies such as cryopreservation technique. Geographically, North America accounted largest share due to high number of ongoing research projects. However, Asia Pacific expected to show significant growth during forecast period owing to supportive government initiatives coupled with increasing awareness about cell therapies.

The global cell banking outsourcing market is witnessing lucrative growth during forecast period due to increased research in cell line development owing to rise in incidence of infectious chronic disorder, and cancer. Additionally, development of advanced preservation techniques, increasing adoption to the stem cell therapies, rise in cell bank facilities across globe, and moving focus of researcher towards stem cell therapies would drive the market. However, high cost of therapies, availability of right donors, and legal and changing ethical issues during collection across the globe are major restraint of the market. Risk associated with cell line banking is contamination of cell lines by manual errors or environmental conditions hence care should be taken during storing and handling of cells.

To receive extensive list of important regions, ask for TOC here @ https://www.persistencemarketresearch.com/toc/8026

Major player in cell banking outsourcing market include BioOutsource (Sartorious), BioReliance, BSL Bioservice, Charles River Laboratories, Cleancells, CordLife, Covance, Cryobanks International India, Cryo-Cell International Inc., GlobalStem Inc., Goodwin Biotechnology Inc., LifeCell International Pvt. Ltd., and Lonza. Additionally, PXTherapeutics SA, Reliance Life Sciences, SGS Life Sciences, Texcell, Toxikon Corporation, Tran-Scell Biologics, Pvt. Ltd., and Wuxi Apptec are other companies in global cell banking outsourcing market.

Reasons to Purchase this Report:

Accuracy and QualityOur reports strive to offer superior quality reports based on authentic and accurate findings.Customer SatisfactionWe aim to ensure that our clients research needs are met with customized, top-of-the-line solutions.Unmatched ExpertiseOur analysts and consultants are among the best in their field and promise to deliver excellent market intelligence.360-degree AnalysisWe leave no stone unturned to give clients an exhaustive coverage of the industry.

For in-depth competitive analysis, Check Pre-Book here @https://www.persistencemarketresearch.com/checkout/8026

Read more:
Cell Banking Outsourcing Market With Economic Growth And Five Forces Analysis By 2021 - Lake Shore Gazette

Global Human Embryonic Stem Cells Market Provides an In-Depth Insight of Sales Analysis, Growth Forecast and Upcoming Trends Opportunities by Types…

The global Human Embryonic Stem Cells market is known to provide a comprehensive and detailed information of the Human Embryonic Stem Cells market for the estimated forecast period. In addition, the report also analyses the overall growth of the market in the estimated forecast period. It also covers and determines the market growth and market share for the estimated forecast period.Moreover, the report provides in depth and detailed analysis for the market in the estimated time frame. It also covers and analysis several segments which are present in the market. Furthermore, detailed analysis is done to determine the competitive landscape of the market share, market size, for the estimated forecast period.

The key vendors list of Human Embryonic Stem Cells market are :

SumanasVericel CorporationAnterogen Co., LtdCesca Therapeutics Inc.Cynata Therapeutics Ltd.Life Technologies CorporationAastrom BiosciencesOrthofix International N.V.Ocata Therapeutics Inc.GenlantisPromoCellNuVasive Inc.BrainStorm Cell Therapeutics Inc.Beike BiotechnologyBioRestorative Therapies Inc.CellTherapies P/LKite Pharma Inc.Lonza Group Ltd.TiGenix N.V

Get a sample of the report from @ https://www.orbisresearch.com/contacts/request-sample/3974192?utm_source=Priyesh

The report is also known to cover detailed and in depth analysis of the major trends which are covered for the global Human Embryonic Stem Cells market. To analyze the global Human Embryonic Stem Cells market the analysis methods used are SWOT analysis and PESTEL analysis. To identify what makes the business stand out and to take the chance to gain advantage from these findings, SWOT analysis is used by marketers. Whereas PESTEL analysis is the study concerning Economic, Technological, legal political, social, environmental matters. For the analysis of market on the terms of research strategies, these techniques are helpful.

Moreover, detailed analysis of the revenues, net income and the strategies which are being implemented are being estimated in the estimated growth of the market. These are also backed up by the analytical and statistical tools which are being used for the estimation of the growth of the global Human Embryonic Stem Cells market. These statistical tools are also used in the filtration and elimination of the data for the global keyword market.

Ask our Expert if You Have a Query at : https://www.orbisresearch.com/contacts/enquiry-before-buying/3974192?utm_source=Priyesh

On the basis of types

Adult SourcesFetal SourcesOthers

On the basis of application

Hematopoietic stem cell transplantationTissue repair damageAutoimmune diseasesAs gene therapy vectors.

One of the most important aspects focused in this study is the regional analysis. Region segmentation of markets helps in detailed analysis of the market in terms of business opportunities, revenue generation potential and future predictions of the market. The uplifting of any region in the global market is dependent upon the market players working in that region.

This can be very well studied through regional segmentation. Every region has a revenue growth graph which is defined by the Analysis of consumption patterns of products and services. For Human Embryonic Stem Cells report, the important regions highlighted are North America, South America, Asia, Europe and Middle East. So basically Global Human Embryonic Stem Cells market report gives in and out knowledge about all the important aspects of the market on a global level.

Place a purchase order @ https://www.orbisresearch.com/contact/purchase-single-user/3974192?utm_source=Priyesh

About Us :

Orbis Research (our website: http://www.orbisresearch.com) is the most comprehensive database of market-related research. Serious researchers from across the globe seeking up-to-date information on the latest market trends with in-depth analyses turn to Orbis Research. Our massive database boasts authentic reports published by leading authors and publications. Orbis highly motivated and expert in-house team undertakes rigorous screening of the credentials of publishers and authors before accepting their submissions. Such vetting is imperative for internal quality control.

Contact Us :

Hector CostelloSenior Manager Client Engagements4144N Central Expressway,Suite 600, Dallas,Texas 75204, U.S.A.Phone No.: +1 (972)-362-8199 ; +91 895 659 5155

Follow this link:
Global Human Embryonic Stem Cells Market Provides an In-Depth Insight of Sales Analysis, Growth Forecast and Upcoming Trends Opportunities by Types...

PD-1 Blocker Safe in Childhood Cancers. But Does It Work? – MedPage Today

PD-1-directed immunotherapy was safe and tolerable in children and adolescents with previously treated cancers, though responses were limited to those with lymphoma, a phase I/II study found.

Four of 20 evaluable lymphoma patients responded to treatment with nivolumab (Opdivo), which included one complete response, reported Crystal Mackall, MD, of Stanford University School of Medicine in California, and colleagues.

But as described online in The Lancet Oncology, single-agent treatment with the immune checkpoint inhibitor appeared to have no activity among the 63 pediatric patients with solid tumors (bone and soft-tissue sarcomas, neuroblastoma, melanoma), where no responses were observed, although the researchers noted that "some pediatric tumor histologies such as Wilms tumor, malignant rhabdoid tumor, and germ-cell tumors" were not represented in the trial.

"Future studies evaluating nivolumab, or other PD-1 or PD-L1 blockers, alone or in combination with other immunomodulators, might be warranted in selected populations of patients with pediatric solid tumors whose tumors manifest higher mutational burden or other biomarkers that provide evidence for increased tumor immunogenicity," Mackall's group wrote.

All responders in the study had some level of PD-L1 expression, which was more common in the subset of lymphoma patients (94%) than in those with other solid tumors (15%). In all, one of 10 patients with non-Hodgkin's lymphoma responded, as did three of 10 with Hodgkin's lymphoma.

"Despite this encouraging activity, the response rate appears lower than the 66-87% overall response rate reported in adults with Hodgkin lymphoma," they noted.

In an accompanying commentary, Jaume Mora, MD, of Hospital Sant Joan de Du in Barcelona, and Shakeel Modak, MD, of Memorial Sloan Kettering Cancer Center in New York City, said that while the pediatric oncology community welcomes new options, most trials using drugs developed in adults tend to be negative, "because we continue to forget that pediatric tumors are disparate from those in adults."

"Pediatric malignancies can be broadly defined as those occurring as a consequence of the complex process of physiological growth, arising from embryonic stem cells and their milieu," they explained. "A general feature for pediatric malignancies is an extremely low rate of mutation, even for metastatic, deadly tumors in which a single gene aberration might be the sole recurrent event."

But Mora and Modak noted that in kids with hypermutant tumors (about 5%) arising from germline mutations in mismatch repair genes, PD-1-directed therapy may be just as effective as it is in adults.

"In our center, two prepubertal children with metastatic melanoma and high tumor mutation burden had complete responses to nivolumab," they said, adding that these responses were durable, lasting a number of years.

From 2015 to 2018, the multicenter Children's Oncology Group ADVL1412 trial enrolled 85 pediatric patients (median age 14, IQR 8-17). The most common tumor types in the trial were osteosarcoma (15%), rhabdomyosarcoma (14%), Hodgkin's (14%) and non-Hodgkin's lymphoma (12%), Ewing sarcoma (13%), and neuroblastoma (6%), followed by epithelioid sarcoma, unspecified sarcoma, undifferentiated sarcoma, and melanoma (1-2% for each).

In the phase I dose-confirmation part of the study, patients received nivolumab 3 mg/kg every 2 weeks. And with no dose-limiting toxicities or dose reductions, this dose was selected for the phase II portion (in which 7% had dose-limiting toxicities).

"The pharmacokinetics of the drug in children were similar to those reported in adults receiving the standard dose of 240 mg every 14 days," the group found.

The most common treatment-related toxicity among 75 evaluable patients was anemia in 47%, followed by fatigue in 37%, decreased white blood cells in 32%, decreased lymphocytes in 29%, and decreased platelets in 19%.

Grade 3/4 adverse events (AEs) occurred in 36%, and liver toxicity was the most common immune-related AE (increases in aspartate aminotransferase and alanine aminotransferase increases of 29% and 24%, respectively), followed by low-grade hypothyroidism (13%) and rash (12%).

Disclosures

Mackall is a founder of and holds equity in Lyell Immunopharma, and also reported relationships with Apricity, NeoImmune Tech, Nektar, PACT Pharma, BryoLogyx, Allogene, and Apricity. One coauthor dislcosed relationships with Epizyme and AstraZeneca.

Mora reported relationships with Ym-Abs Therapeutics, Takeda Colombia, EUSA Pharma Iberia, the Clinigen Group, Lilly, and Merck Sharp & Dohme Spain. Modak disclosed fees from Ym-Abs Therapeutics, Progenics, and Illumina.

Continued here:
PD-1 Blocker Safe in Childhood Cancers. But Does It Work? - MedPage Today

YAP1 is a potent driver of the onset and progression of oral squamous cell carcinoma – Science Advances

Abstract

Head-and-neck squamous cell carcinoma (HNSCC) is the sixth most common group of cancers in the world, and patients have a poor prognosis. Here, we present data indicating that YAP1 may be a strong driver of the onset and progression of oral SCC (OSCC), a major subtype of HNSCC. Mice with tongue-specific deletion of Mob1a/b and thus endogenous YAP1 hyperactivation underwent surprisingly rapid and highly reproducible tumorigenesis, developing tongue carcinoma in situ within 2 weeks and invasive SCC within 4 weeks. In humans, precancerous tongue dysplasia displays YAP1 activation correlating with reduced patient survival. Combinations of molecules mutated in OSCC may increase and sustain YAP1 activation to the point of oncogenicity. Strikingly, siRNA or pharmacological inhibition of YAP1 blocks murine OSCC onset in vitro and in vivo. Our work justifies targeting YAP1 as therapy for OSCC and perhaps HNSCC, and our mouse model represents a powerful tool for evaluating these agents.

Head-and-neck squamous cell carcinoma (HNSCC) is the sixth most common group of cancers in the world, affecting 600,000 people annually. About half of HNSCC patients die from their disease (1). The head and neck region of the body includes the oral cavity, larynx, and pharynx, all structures that are covered with squamous epithelium. Among HNSCC subtypes, oral SCC (OSCC) is the most frequent, and tongue cancers comprise a large proportion of OSCCs (2). Because 15% of HNSCC patients carry the human papillomavirus (HPV), HPV is considered to be one of the major causes of HNSCC. HPV (+) HNSCC usually occurs in the oropharynx, and patients with this malignancy have better prognoses or may even be cured (1). In contrast, the 85% of HNSCC that are HPV () are highly resistant to even intensified chemo/radiotherapy (3) as well as to currently available molecular targeting drugs (4). The fundamental molecular mechanisms underlying the onset and development of HPV () HNSCC have yet to be identified, hampering the generation of new therapeutic strategies.

The Cancer Genome Atlas (TCGA) project has revealed the presence of many altered gene exons in HNSCC (2). In HPV () HNSCC, TP53 was highly mutated in 84% of cases. In addition, mutation of FAT atypical cadherin1 (FAT1) was observed in 32%, epidermal growth factor receptor (EGFR) in 15%, and Ajuba LIM protein (AJUBA) in 7% of all HPV () HNSCC. Strikingly, these mutations were rare in HPV (+) HNSCC, with even TP53 mutation at only 3%. Notably, mutations of phosphoinositide 3 kinase, catalytic subunit alpha (PIK3CA)/phosphatase and tensin homolog (PTEN; 50 to 60%) and TP63 (20 to 30%) were commonly observed in both HPV (+) and HPV () HNSCC. Considering that HPV E6 strongly inactivates TP53 (5), TP53 inactivation must be a crucial and common oncogenic event in HNSCC. However, loss of TP53 alone in mice never induces spontaneous HNSCC in vivo (6), meaning that other genetic and/or epigenetic alterations are also essential for HNSCC generation.

The core components of the Hippo pathway are the mammalian STE20like (MST) kinases, large tumor suppressor homolog (LATS) kinases, nuclear Dbf2related (NDR) kinase, and the adaptor proteins Salvador homolog 1 (SAV1) and Mps one binder kinase activator 1 (MOB1) (7). MOB1A/B are the adaptor proteins for both the LATS1/2 and NDR1/2 kinases, and by binding to LATS/NDR, MOB1A/B strongly increase the enzymatic activities of these kinases (7). Activated LATS/NDR kinases, in turn, phosphorylate Yes-associated protein 1 (YAP1) and transcriptional coactivator with PDZ-binding motif (TAZ; also known as WWTR1). YAP1/TAZ are key downstream transcriptional cofactors that act mainly on TEA domain transcription factors (TEADs) to regulate numerous target genes involved in cell growth and differentiation (7). After phosphorylation by LATS/NDR kinases, YAP1/TAZ are excluded from the nucleus and retained in the cytoplasm, where they are ubiquitylated by E3-ubiquitin ligase SCFTRCP (also known as BTRC) and subjected to proteasome-mediated degradation (7). Thus, in most cell types, YAP1/TAZ are essentially positive regulators of cell proliferation that are negatively controlled by upstream Hippo core components. In vitro, YAP1/TAZ can be regulated by cell density, external mechanical forces, polarization, rigidity of the extracellular matrix, stress stimuli (7), or engagement of a G proteincoupled receptor (GPCR) by a soluble mediator (7). In vivo, YAP1 activation in mice results in organomegaly and tumor formation (8).

Several lines of evidence suggest a role for YAP1 in HNSCC. (i) Location 11q22 in the human YAP1 locus is amplified in 8.6% of HNSCC (9); (ii) YAP1 activity is associated with malignant phenotypes and poor prognosis both in vitro and in vivo (9, 10); and (iii) mutations of TP53, PIK3CA/PTEN, EGFR, or FAT1, which are often observed in HNSCC, increase YAP1 activation in several cell types (1114). HNSCC also frequently shows amplification of TP63, a master regulator of squamous cells, but the effect of this alteration on YAP1 activity is controversial (15, 16).

We previously reported that Mob1a/b null mutant mice succumb to embryonic lethality at embryonic day 6.5 (17). We have also demonstrated that Mob1a/b loss induces extreme hyperactivation of endogenous YAP1/TAZ, resulting in the most severe phenotypes reported among mice mutated in Hippo core components in various tissues (17). Thus, MOB1A/B is a crucial hub in the Hippo signaling pathway. Because of the accumulating evidence in the literature on the importance of YAP1 in HNSCC progression, we generated tongue epitheliumspecific Mob1a/b double knockout (tgMob1DKO) mice and examined them to dissect the function of endogenous YAP1 in the onset and progression of the OSCC subtype of HNSCC. We demonstrate that hyperactivation of endogenous YAP1 induced by loss of Mob1a/b triggers surprisingly early onset and rapid progression of OSCC. Our data reveal that YAP1 is a powerful oncogenic driver of this malignancy.

To investigate the role of the Hippo-YAP1 pathway in mouse tongue epithelium in vivo, we used our previously generated strain of tamoxifen (TAM)inducible Mob1a/bDKO mice [Rosa26-CreERT; Mob1aflox/flox; Mob1b/ (tgMob1DKO) mice], which were created by mating Rosa26-CreERT transgenic (Tg) mice with Mob1aflox/flox and Mob1b/ mice (17). Intraperitoneal injection of TAM into these animals causes early death at about 3 weeks due to widespread organ dysfunction, including hepatic failure (17). To extend mouse survival, we applied TAM directly and only to the tongue epithelium for 5 days starting on postnatal day 21 (P21; Fig. 1A and fig. S1A). Cre-mediated deletion of the floxed Mob1a gene was substantially achieved by 3 days after the initiation of TAM application (fig. S1B), with the MOB1A and MOB1B proteins being essentially absent by day 7 after TAM (fig. S1C).

(A) Diagram of the protocol to generate tongue epithelial cellspecific Mob1a/b DKO mice (tgMob1DKO). TAM was applied by a soft brush daily for 5 days to the tongues of 3-week-old Mob1aflox/flox; Mob1b/ (control) and Rosa26-CreERT; Mob1aflox/flox; Mob1b/ (mutant) mice. Mice were sacrificed at 1, 2, or 4 weeks (red arrows) after starting TAM application, and their tongue tissues were removed for histological analyses. (B) Representative macroscopic (small panels) and microscopic (large panels) views of H&E-stained sections of control (top) and tgMob1DKO (bottom) tongue epithelial layers at the indicated weeks after starting TAM application. White arrow, deep ulcer formation. Scale bars, 1 mm (small panels) and 100 m (large panels). Photo credit: Hirofumi Omori, Kobe University. (C) Percentages of the indicated lesion types present in the tongues of the mutant mice (n = 10 per group) in (B) at the indicated weeks after TAM. (D) H&E-stained sections of control and tgMob1DKO tongue epithelium at 1 week after TAM. Moderate nuclear heterogeneity and loss of polarity are apparent in the mutants, indicating dysplasia. Scale bar, 5 m. (E) H&E-stained sections of mutant tongue epithelium at 2 weeks after TAM showing atypical mitotic figures (left), nuclear enlargement (middle), and strongly heteromorphic cells (right), indicating CIS. Scale bar, 5 m. (F) H&E-stained section of mutant tongue epithelium at 4 weeks after TAM revealing submucosal invasive SCC. White arrowheads, cancer cells penetrating beyond the basement membrane (yellow dashed line). Scale bar, 10 m.

Macroscopically, the epithelial surface of tgMob1DKO tongue showed mild roughness at 1 week after TAM, very rough mucosa accompanied by keratosis at 2 weeks after TAM, and deep ulceration at 4 weeks after TAM (Fig. 1B). To our surprise, by 1 week after TAM, histological examination revealed an increased number of polymorphic epithelial cells with hyperchromatic nuclei and loss of polarity, evidence of dysplasia (Fig. 1, C and D). Although Ki67 was expressed only in the basal cells of the tongue epithelium before TAM treatment, the percentage of Ki67-positive cells among polymorphic epithelial cells increased markedly by 1 week after TAM (fig. S1D), demonstrating the increased proliferative capacity of MOB1-deficient epithelial cells. Atypical mitotic figures (Fig. 1E, left), nuclear enlargement (Fig. 1E, middle), and strongly heteromorphic cells (Fig. 1E, right) indicative of carcinoma in situ (CIS) were observed in the tongue as early as 1 week after TAM (Fig. 1C and fig. S1E). All mice developed tongue CIS by 2 weeks after TAM (Fig. 1, B, C, and E), and all mice developed invasive SCC by 4 weeks after TAM (Fig. 1, B, C, and F). Almost all of these SCC-bearing mutants died by 8 weeks after TAM, most likely due to malnutrition caused by their dysphagia. Because there were no significant histological differences among Mob1a+/+; Mob1b+/+ mice treated with TAM, Rosa26-CreERT; Mob1a+/+; Mob1b+/+ mice with TAM, Rosa26-CreERT; Mob1aflox/flox; Mob1b/ mice without TAM, and Mob1aflox/flox; Mob1b/ mice with TAM (fig. S1F), we used Mob1aflox/flox; Mob1b/ mice with TAM as controls for subsequent experiments unless otherwise stated. These studies were designed to explore why altered Hippo signaling induced the extremely rapid onset of tongue cancers.

We established a TAM-inducible Mob1a/bDKO tongue epithelial cell line (iMob1DKO cells) and treated them in vitro with (+) or without () TAM. Compared to control iMob1DKOTAM cells, iMob1DKO+TAM cells showed increased cell proliferation and saturation density (Fig. 2A). When cultures of these overconfluent iMob1DKO+TAM cells were stained to detect the tight junction protein ZO-1, we found only weak staining of this protein in the tight junctions, indicating impaired cell polarity (fig. S2A). In contrast, cultures of iMob1DKOTAM cells showed normal ZO-1 staining in the tight junctions. Because there was no difference in cell size between iMob1DKO+TAM and iMob1DKOTAM cells (fig. S2B), we concluded that cell-cell contact inhibition was impaired in the absence of Mob1a/b. In addition, the number of apoptotic cells was decreased in the mutant culture compared to the control (Fig. 2B). Next, to determine how MOB1 inactivation affected the self-renewal of tongue epithelial stem cells, we quantified the capacity of control (TAM) and mutant (+TAM) iMob1DKO cells to form colonies in culture. A lack of Mob1a/b induced a 2.2-fold increase in colony-forming efficiency (Fig. 2C, left panels). When these primary colonies were replated to test their ability to form secondary colonies, a 2.8-fold increase in secondary colony-forming efficiency was observed in the absence of Mob1a/b (Fig. 2C, right panels). A comparison of cell cycle and cell ploidy in iMob1DKOTAM versus iMob1DKO+TAM cells revealed a decrease in G0-G1 phase cells and increases in S phase cells and aneuploid cells in the mutant culture (Fig. 2D). Indirect immunofluorescence (IF) analysis of control and mutant cells using anti-tubulin and anti-tubulin antibodies uncovered increases in multipolar spindle formation (Fig. 2E) and micronuclei (Fig. 2F) in mutant cells, indicating chromosomal instability. Thus, the increases in cell proliferation and stem cell self-renewal observed in the absence of Mob1a/b, coupled with chromosomal instability, resistance to apoptosis, and inadequate cell contact inhibition, may underlie the rapid onset and development of tongue cancer in TAM-treated tgMob1DKO mice.

(A) Absolute numbers of iMob1DKO tongue epithelial cells that were left untreated (control; iMob1DKOTAM cells) or treated with 0.5 M TAM for 3 days (iMob1DKO+TAM cells) and then grown for the indicated number of days in the absence of TAM. (B) Flow cytometry (left) and quantitation (right) of propidium iodide (PI)positive dead cells in the cultures in (A). (C) iMob1DKO cells were treated in vitro with TAM (0.5 M) for 3 days (+TAM) or left untreated (TAM) and serially plated to generate first primary colonies and then secondary colonies. Crystal violet staining (left) and colony counts (right) of primary (left side) and secondary (right side) colonies were performed on day 7 after plating. Photo credit: Hirofumi Omori, Kobe University. (D) Top left: DNA content frequency histograms of control (iMob1DKOTAM) and Mob1a/b mutant (iMob1DKO+TAM) tongue epithelial cells. Right: Percentage of cells from the top left panels in the G0-G1, S, and G2-M phases of the cell cycle as determined by fractional DNA content. Bottom left: Overlay of aneuploid and polyploid cell numbers for the cells in the right panel. (E and F) Top: Immunostaining to detect -tubulin (green) and -tubulin (red) in control (iMob1DKOTAM) and mutant (iMob1DKO+TAM) tongue epithelial cells. DAPI (blue), nuclei. Scale bars, 1 m. Multipolar spindles and micronuclei (white arrow) were detected in mutant cells. Bottom: Quantitation of the percentage of cells in the top panels showing multipolar spindles (E) and micronuclei (F). Data are shown as means SEM of triplicate samples. *P < 0.05, **P < 0.01, and ***P < 0.001, t test. ns, not significant; i.p., intraperitoneally.

We next investigated the biochemical effects of Mob1a/b loss on Hippo components in iMob1DKO cells that were left untreated or treated with TAM for 7 days. As expected, iMob1DKO+TAM cells showed a reduction in LATS1 protein and an increase in the total protein levels of YAP1. Protein levels of several representative direct transcriptional targets of YAP1, including connective tissue growth factor (CTGF), baculoviral IAP repeat-containing protein 5 (BIRC5), and topoisomerase II-alpha (TOP2A), were also significantly elevated. However, there was no effect on total TAZ protein (Fig. 3A). Furthermore, YAP1 was predominantly localized in the nuclei of iMob1DKO+TAM cells even when cultured under highcell density conditions (Fig. 3B). Thus, YAP1 hyperactivation is a prominent feature of mutant tongue epithelial cells prone to OSCC development.

(A) Top: Immunoblots to detect the indicated proteins in total extracts of iMob1DKO tongue epithelial cells that were left untreated (TAM; control) or treated with TAM (+TAM) for 7 days. GAPDH, loading control. Bottom: Densitometric relative quantitation of the indicated proteins in the blots in the top panels. (B) Left: Immunostaining to detect YAP1 in iMob1DKOTAM and iMob1DKO+TAM tongue epithelial cells that were plated at low or high cell density. Scale bar, 10 m. Right: Percentages of cells in the cultures in the left panels that showed higher YAP1 levels in the nucleus (nuc YAP1) than in the cytoplasm (cyto YAP1). (C) Left: Representative H&E-stained sections (top panels) and macroscopic views (bottom panels) of tongue epithelium from control, tgMob1DKO, tgYap1TKO (tgMob1DKO plus Yap1 KO), and tgTazTKO (tgMob1DKO plus Taz KO) mice at 4 weeks after TAM (n = 10 mice per group). Scale bars, 100 m (top panels) and 1 mm (bottom panels). Right: Percentages of mice in the left panels displaying the indicated lesions. Photo credit: Hirofumi Omori, Kobe University. (D) Quantitation of SCC invasion depth in tongue epithelium of the mice in (C). The depth of invasion was measured from the level of the nearest adjacent normal mucosa to the extent of the deepest tumor invasion into the tongue musculature. Data are shown as means SEM of triplicate samples. *P < 0.05, **P < 0.01, and ***P < 0.001, t test.

To clarify the role of YAP1 in OSCC-related phenotypes, we generated strains of triple KO mice lacking MOB1A/B plus YAP1 (tgYap1TKO), or lacking MOB1A/B plus TAZ (tgTazTKO). Unlike tgMob1DKO mice, which all develop invasive SCC at 4 weeks after TAM, MOB1A/B-deficient mice also lacking YAP1 showed only mild to moderate dysplasia in the tongue (Fig. 3C and fig.S2C). In contrast, MOB1A/B-deficient mice also lacking TAZ developed a highly aggressive form of invasive SCC, with some lesions penetrating from the tongue surface into the floor of mouth. The measured depth of invasion of malignant cells into the mouth floor was significantly increased in tgTazTKO mice compared to tgMob1DKO mice (Fig. 3D). In addition, immunohistochemical (IHC) staining to detect YAP1/TAZ revealed that tgMob1DKO mice showed increased frequency of nuclear YAP1 localization compared to controls, but no alteration in the frequency of nuclear TAZ (fig. S2C). These results were further confirmed by IHC staining to visualize YAP1 or TAZ in the tongues of tgYap1TKO and tgTazTKO mice (fig. S2C). Thus, the MOB1A/B-deficient phenotype is largely dependent on YAP1 rather than on TAZ.

We speculated that inhibition of YAP1 hyperexpression might prevent the development of tongue cancer in our tgMob1DKO mice. To choose a compound to exert YAP1 inhibition in vivo, we first tested the effects of the candidate compounds dasatinib, simvastatin, verteporfin, and the Rock inhibitor Y-27632 on YAP1 protein expression in the human OSCC cell line HSC4 (fig. S3A). We also evaluated the effects of these drugs on YAP1 activity in H1299-Luc cells in a reporter assay (fig. S3B). Dasatinib was the most effective YAP1 inhibitor in both of these assays, guiding us to choose dasatinib for our in vivo experiments. Biochemically, dasatinib is a multikinase inhibitor that efficiently blocks Src family kinases such as SRC, LCK, YES, and FYN (18). SRC directly and indirectly activates YAP1, and inhibition of SRC by dasatinib has been shown to efficiently suppress YAP1 activation (19).

To investigate the effect of pharmacological YAP1 inhibition on our TAM-inducible tgMob1DKO mice, we treated these animals with dasatinib or dimethyl sulfoxide (DMSO; vehicle control) 3 days before applying TAM ointment to the tongue (Fig. 4A). The mice were then sacrificed at 2 weeks after TAM. We found that dasatinib treatment strongly blocked both YAP1 protein expression (Fig. 4B) and the excessive cell proliferation associated with YAP1 hyperactivation (Fig. 4C). Macroscopically, the mucosal irregularity accompanied by keratinization obvious in tgMob1DKO+TAM mice had improved after dasatinib treatment (Fig. 4D). Histological examination of tongue epithelial cells revealed that, whereas DMSO-treated control mice all developed CIS at 2 weeks after TAM, the onset of CIS in dasatinib-treated mice was completely blocked, although a mild or moderate dysplasia was still present (Fig. 4D). Thus, dasatinib inhibits the onset of YAP1-induced tongue carcinomas. To confirm this effect of YAP1 inhibition in vivo, we treated tgMob1DKO+TAM mice with simvastatin in the same fashion and observed results similar to those achieved with dasatinib (fig. S3C). These data suggest that drug-mediated inactivation of YAP1 could be of therapeutic benefit in OSCC.

(A) Diagram of the protocol of the chemoprevention assay. tgMob1DKO mice received daily intraperitoneal injection of dasatinib or DMSO (control; n = 6 per group) for a total of 17 days starting 3 days (P18) before TAM application on P21. Mice were sacrificed at 2 weeks after TAM. (B) Representative images of IF detection of YAP1 in tongue epithelium from the dasatinib- or DMSO-treated mice in (A). Scale bar, 50 m. (C) Top: Representative Ki67 immunostaining of tongue epithelium from the mice in (A). Scale bar, 50 m. Bottom: Percentages of Ki67-positive cells in the sections in the top panels. (D) Top: Representative H&E staining of sections (left panels) and macroscopic views (right panels) of tongues from DMSO-treated (n = 6) or dasatinib-treated (n = 6) tgMob1DKO mice after 2 weeks of treatment. Scale bars, 100 m (left panels) and 1 mm (right panels). Normal, H&E-stained section of a tongue from a tgMob1DKO mouse treated with DMSO but not TAM (control). Bottom: Percentages of the DMSO- or dasatinib-treated mice in (A) showing the indicated lesions. Photo credit: Hirofumi Omori, Kobe University. (E) Growth in culture of SCC9 cells that Dox-inducibly overexpressed constitutively active YAP1 (YAP1-5SA) and were treated (+) or not () with Dox. (F and G) Growth in culture of HSC4 cells that were left untreated (parent) or treated with (F) si-scramble (siSC#1; control) or siYAP1#1 or (G) DMSO (control), dasatinib, verteporfin, or simvastatin. (H and I) Left: Volumes of tumors in nude mice (n = 12 per group) that were xenografted subcutaneously with (H) Dox-inducible shYAP1-expressing HSC4 cells or (I) unmodified HSC4 cells. Mice were supplied with (H) normal drinking water or water containing Dox (2 mg/ml), or (I) DMSO or dasatinib that was administered intraperitoneally on day 10 when tumors became visible. Right: Representative macroscopic view of the tumors evaluated in the left panels of (H) and (I) at 16 days after treatment. Scale bars, 10 mm. (J) Diagram of the protocol of the chemotherapy assay. tgMob1DKO mice received daily intraperitoneal injection of dasatinib or DMSO (n = 6 per group) for 2 weeks starting at 2 weeks after TAM. Mice were sacrificed at 7 weeks of age immediately at treatment end (right red arrow). (K) Top: Representative Ki67 immunostaining of tongue epithelium from the mice in (J) after 2-week treatment. Scale bar, 50 m. Bottom: Percentage of Ki67-positive cells in the sections in the top panels. (L) Left: H&E-stained sections (left panels) and macroscopic views (right panels) of the tongues of the mice in (J) after 2-week treatment. Scale bars, 100 m (left panels) and 1 mm (right panels). Right: Percentages of the mice in (J) whose tongues exhibited the indicated lesions after 2-week treatment. Photo credit: Hirofumi Omori, Kobe University. Data are shown as means SEM. *P < 0.05 and ***P < 0.001, t test.

Our findings that YAP1 activation causes very early OSCC onset, and that loss of YAP1 prevents the appearance of these tumors, prompted us to theorize that YAP1 must be a potent oncogenic initiator of OSCC. We next investigated whether YAP1 plays a crucial role in not only tumor initiation but also tumor progression. We engineered the human OSCC cell line SCC9, which features only low YAP1 expression (fig. S4, A and B), to overexpress YAP1 by transfecting it with a plasmid driving expression of the constitutively active YAP1-5SA mutant protein (fig. S4C). YAP1-overexpressing SCC9 cells showed greatly enhanced proliferation in vitro (Fig. 4E). We then transfected HSC4 cells, which naturally feature strong YAP1 expression (fig. S4, A and B), with YAP1 small interfering RNA (siRNA; fig. S4D) or treated them with a YAP1 inhibitor such as dasatinib, simvastatin, or verteporfin. In all these cases, YAP1 inhibition significantly suppressed HSC4 cell proliferation in vitro (Fig. 4, F and G). Moreover, siRNA-mediated YAP1 knockdown enhanced the sensitivity of HSC4 cells to the chemotherapeutic cisplatin (fig. S4E), implying that combining a YAP1 inhibitor with cisplatin might be an attractive new approach for OSCC therapy.

To examine the effects of YAP1 inhibition in vivo, we first xenografted doxycycline (Dox)inducible shYAP1-transfected HSC4 cells (fig. S4F) into nude mice, which were then supplied with normal drinking water (control) or water containing Dox. We found that Dox-induced inhibition of YAP1 expression efficiently suppressed the ability of these modified HSC4 cells to grow into tumors in vivo (Fig. 4H). We then xenografted unmodified HSC4 cells into nude mice and treated these animals with DMSO or dasatinib. Again, blocking YAP1 activity decreased OSCC development in these mice (Fig. 4I).

Last, we applied these findings to our TAM-induced tgMob1DKO mouse model of tongue cancer. We treated TAM-inducible tgMob1DKO mice with dasatinib soon after CIS onset at 2 weeks after TAM (Fig. 4J). Tumor cell proliferation was inhibited compared to DMSO-treated controls (Fig. 4K), and the progression of these lesions into invasive tongue cancer had slowed significantly at 4 weeks after TAM (Fig. 4L). Histological analysis revealed that there was no significant increase in TUNEL+ (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick end labelingpositive) cells in the tongues of dasatinib-treated tgMob1DKO+TAM mice, indicating that dasatinib did not increase apoptosis but rather blocked cell proliferation (fig. S4G).

Together, these data indicate that endogenous YAP1 hyperactivation is involved in both OSCC onset and progression and is a driving force in tongue cancer in mice and humans. These results further strengthen our contention that YAP1 inhibitors may be promising novel agents for OSCC therapy.

Previous reports had suggested that nuclear localization of YAP1 was frequently observed at the precancerous stage of human OSCC (10). We obtained samples of nontumorous tongue tissue (NT-control) and tongue dysplasia, CIS, or invasive SCC from 86 patients at the National Hospital Organization Kyushu Cancer Center. These samples were immunostained to detect YAP1, and YAP1 levels were quantified using a grade scale (see Fig. 5A and Materials and Methods). As expected, NT-control epithelium showed weak YAP1 expression (mean grade = 0.7) only in the basal layer, with negligible YAP1 expression above the basal layer (Fig. 5, A and B). Most patients with tongue dysplasia showed enhanced YAP1 expression (mean grade = 3.5) in the nonbasal upper layer, indicating that YAP1 expression is higher than in controls from the early precancerous stage. Patients with CIS in the tongue displayed stronger nuclear staining of YAP1 than dysplastic patients, and patients with invasive SCC exhibited much more intense YAP1 staining than either of these (Fig. 5, A and B). We next tested for YAP1 activation using IHC evaluation of the expression of the YAP1 target genes CTGF, BIRC5, and TOP2A. In examining 14 OSCC specimens with high YAP1 protein levels and 14 specimens with low YAP1 protein levels, we found that CTGF protein tended to rise in the YAP1-high group (fig. S5A), and that the BIRC5 (fig. S5B) and TOP2A (fig. S5C) proteins were increased significantly in these same specimens. Thus, YAP1 activation appears to have a very important function in the onset and progression of tongue cancer not only in mice but also in humans.

(A) Left: Low-magnification (top panels; scale bar, 40 m) and high-magnification (bottom panels; scale bar, 10 m) views of representative YAP1-immunostained plus hematoxylin-counterstained sections of normal human tongue (mean YAP1 activity grade = 0.67; n = 56), dysplasia (mean grade = 3.5; n = 63), CIS (mean grade = 4.8, n = 26), and invasive SCC (mean grade = 6.4, n = 86). Right: Determination of YAP1 grade. Representative sections from the left panels were scored for YAP1 frequency and intensity as indicated. Scale bars, 10 m (frequency) and 3 m (intensity). The YAP1 grade was the product of these scores (see Materials and Methods). (B) Compilation of YAP1 grade scores in sections of human normal tongue, and tongues with dysplasia, CIS, or invasive SCC. Data are shown as means SEM. *P < 0.05 and ***P < 0.001, t test. (C) Kaplan-Meier curves showing overall survival (left) and relapse-free survival (right) of 86 tongue cancer patients who underwent surgical resection. The patients were divided into a high YAP1 expression group (n = 14) and a low YAP1 expression group (n = 72; see table S1). **P < 0.01 and ***P < 0.001, Wilcoxon test.

We then looked at the effect of high YAP1 expression on the overall survival and relapse-free survival of human tongue cancer cases. We examined the histories of our 86 selected tongue cancer patients, each of whom had undergone surgical resection at the National Hospital Organization Kyushu Cancer Center. We found that high YAP1 expression in human tongue cancer patients (n = 14) correlated with lymph node metastasis (table S1), decreased overall survival (Fig. 5C, left), and reduced relapse-free survival (Fig. 5C, right). Thus, elevated YAP1 activity in human tongue cancer is a negative prognostic indicator.

Human HNSCCs often bear mutations of TP53, elements of PI3K/PTEN signaling, FAT1, or elements of EGFR signaling (2). All of these entities have been previously reported to activate YAP1 in one or more cell types (1114). Mutation of TP63, a master regulator of squamous cells, is also frequently observed in human HNSCC, but its effects on YAP1 remain under debate (15, 16). We hypothesized that one or more of these mutations would activate YAP1 in transformed epithelial cells from an OSCC patient.

The WSU-HN30 human HNSCC cell line is HPV (), low in EGFR, and wild type for TP53, FAT1, and PTEN (20). We transfected these cells with siRNA against TP53, PTEN, or FAT1 (fig. S6A) or treated them with EGF (1 g/ml) for 24 hours. All of these cultures increased their expression and/or activation of YAP1 as determined by immunoblotting to measure YAP1/glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and/or YAP1/phosphorylated YAP1 (pYAP1) ratios (Fig. 6, A and B, and fig. S6B). Nuclear YAP1 protein was also enhanced in these manipulated cells as detected by IF staining (Fig. 6C and fig. S6C). We next investigated the expression of CTGF, BIRC5, and TOP2A, which are major downstream targets of YAP1, and found that their mRNA levels were increased either by the silencing of TP53, PTEN, or FAT1 or by EGF treatment (fig. S7A). To confirm our results in another cell line derived from HPV () OSCC, we subjected Cal27 cells (TP53mt, PTENwt, and FAT1wt) to PTEN or FAT1 knockdown, or EGF treatment, and again detected up-regulation of YAP1 activity (fig. S7, B and C). Moreover, we found a positive correlation between TP53mt and YAP1 expression in our human clinical specimens (table S1). Thus, it seems that mutation of any of these tumor suppressor genes and/or increased EGF signaling can up-regulate YAP1 expression to some degree in OSCC cells. Intriguingly, some combinations of these gene alterations resulted in YAP1 activation to a high level (Fig. 6D). Thus, an accumulation of these mutations may explain the increased and sustained activation of YAP1 in head-and-neck cancer epithelial cells.

(A and B) Left panels: Immunoblots to detect YAP1 and pYAP1 in WSU-HN30 cells that were either (A) transfected with control siRNA (siSC#1) or with one of three independent siRNAs (#1 to #3) targeting TP53, PTEN, or FAT1 or (B) left untreated (Parent) or treated with EGF (1 g/ml). siRNA- or EGF-treated cells were harvested at 24 or 96 hours after treatment, respectively. Right panels: Ratios of YAP1/GAPDH (protein) and YAP1/pYAP1 (activity) were calculated as described in Materials and Methods. Data are presented as means SEM of (A) seven independent siRNA-transfected samples for each gene or (B) three EGF-treated cultures per group. (C) Top: IF-based detection (see Supplementary Materials and Methods) of nuclear versus cytoplasmic YAP1 in siRNA-transfected or EGF-treated WSU-HN30 cells treated as in (A) and (B). DAPI (blue), nuclei. Bottom: Ratio of cells with nuclear YAP1/cytoplasmic YAP1 in the top panels. Data are means SEM of three independent siRNA-transfected samples for each gene (siRNA transfection) or three cultures treated with EGF. (D) Top: Immunoblot to detect YAP1 and pYAP1 in WSU-HN30 cells that were transfected with the indicated siRNAs. Middle and bottom: Ratios of YAP1/GAPDH and YAP1/pYAP1 were analyzed and quantified as in (A) and (B). Data are means SEM of four independent experiments involving at least triplicate samples. *P < 0.05 and **P < 0.01, t test.

With respect to TP63, Mob1 deletion enhanced TP63 protein (p63) levels in mouse tongue epithelial cells (fig. S8A), and siRNA-mediated inhibition of Tp63 expression in SCC9 cells expressing Dox-inducible YAP1-5SA blocked their proliferation (fig. S8B). In addition, overexpression of Np63 only mildly interfered with YAP1 activation in the WSU-HN30 human tongue epithelial cell line (fig. S8, C to E).

The above data collectively indicate that TP53, FAT1, PTEN, and EGFR are all upstream regulators of YAP1, whereas TP63 is a downstream effector of YAP1. These findings prompted us to devise a model in which the mutation (functional inactivation) of TP53 plus a subset of these genes, including PIK3CA/PTEN, EGFR, and/or FAT1, results in YAP1 hyperactivation that may exceed an oncogenic threshold (fig. S9A). This elevated YAP1 may then activate downstream genes such as Np63 and may thereby initiate OSCC onset and/or progression.

In this study, we have demonstrated for the first time that YAP1 may be a strikingly potent oncogenic driver of OSCC onset and progression. Cancers usually initiate because of the additive or synergistic effects of several mutated genes that exert their effects during multistep carcinogenesis (1). However, because the onset of tongue tumors in our tgMob1DKO mice was so quick, we propose a new concept positing that OSCC may be initiated when sustained YAP1 activity exceeds a particular oncogenic threshold (refer to fig. S9A). Many recent reports have linked YAP1 activation to either loss-of-function (LOF) mutations of key genes such as TP53 and FAT1, or the triggering of pathways related to PI3K/AKT or EGFR (1114). We have confirmed these findings in human OSCC cells (Fig. 6, A to C, and fig. S7) and have established that an accumulation of YAP1 activity can be driven by various combinations of these alterations (Fig. 6D). Depending on the strength of YAP1 activation attributed to one alteration, the oncogenic threshold may be exceeded with only a few additional mutations.

The role of TP53 in OSCC poses an interesting conundrum. LOF of TP53 inhibits expression of PTPN14 and 14-3-3, which are downstream transcriptional targets of TP53 (11, 21), and so is likely to promote YAP1 activity. However, TP53 gain-of-function (GOF) mutations (e.g., R248L, R175H, and R273H), which are observed in 9.5% of HNSCCs, reportedly bind directly to and stabilize YAP1 (22), also promoting YAP1 activity. The binding of GOF-mutated TP53 to YAP1 can activate transcription factors such as NF-Y, whose target genes act to increase cell proliferation (23). Thus, both LOF and GOF mutations of TP53 can enhance YAP1 activity and so may contribute to human OSCC carcinogenesis. Nevertheless, because mice solely lacking normal TP53 function do not develop OSCC (6), there must be other factors required for the onset and development of OSCC.

Repeated exposure to carcinogens (including tobacco and alcohol), irritation of the oral mucosa (especially tongue epithelium) due to the presence of tooth decay, or mechanical stimulation by ill-fitting dentures are the main causes of human OSCC (1, 24). These events may also directly activate YAP1 or induce oncogenic mutations in the abovementioned genes that activate YAP1. Cigarette smoke extract (25) and mechanical stimulation (26) have both been shown to activate YAP1 in various cell types, including in esophageal and cervical cells. These observations support our hypothesis that OSCC is caused by the boosting of YAP1 activity over a certain threshold. Furthermore, although YAP1 protein itself is frequently activated and accumulates in most tumors (8), the actual DNA mutation of Hippo-related genes, including YAP1, is relatively rare in cancers (27). Thus, our work erases many years of doubt as to how HNSCCs can arise in the absence of GOF mutations of major oncogenes (28).

One possible reason for the frequent and early onset of OSCC in our mutant mice is the activation of Np63, a master regulator of epidermal keratinocyte proliferation and differentiation (29). Activated YAP1 binds directly to Np63 protein and stabilizes it (30). A lack of TP63 in mice results in the absence of the epidermis and its related appendages (29), and Tp63-deficient embryonic stem cells exhibit up-regulation of mesodermal genes (31). Conversely, overexpression of Np63 in the presence of KLF4 induces the conversion of fibroblasts to cells of the keratinocyte lineage (32). We found that TP63 accumulated in tongue epithelial cells in our mouse model of OSCC (fig. S8A). Last, we demonstrated that inhibition of Np63 expression blocked the cell proliferation induced by YAP1 overexpression (fig. S8B). We speculate that hyperactivation of YAP1 leading to high levels of stabilized Np63 may both skew cells toward the keratinocyte lineage and boost keratinocyte proliferation and dedifferentiation, which may, in turn, increase the chance of OSCC development. A second reason for the early onset of invasive SCC in our mutant mice may be increased production of BMP4. BMP4 is a soluble growth factor that plays an essential role in epidermal development by regulating Np63 (33). High levels of BMP4 were detected in tgMob1DKO tongue epithelial cells compared to controls when examined by microarray analysis (fig. S9B). A third possible reason for our observations may be the existence of positive feedback between EGF signaling and YAP1. YAP1 increases the transcription of EGF receptors (EGFR and ERBB3) and EGF-like ligands (HBEGF, NRG1, and NRG2) (16). Conversely, both HBEGF and NRG1 have been shown to activate YAP1 in ovarian cancer (14). Although we did not observe a significant increase in EGFR, ERBB3, or HBEGF mRNAs when MOB1 was deleted (YAP1 activated) in mouse tongue epithelium, we did detect elevation of NRG1/2 mRNAs (fig. S9B), suggesting the existence of an NRG1/2-(ERBB3)-YAP1-NRG1/2 autocrine loop that controls OSCC tumorigenesis and progression. All three of these mechanisms may contribute to OSCC genesis, perhaps explaining why the phenotype is so strong, especially in epidermal cells.

An important finding emerging from our study is that mice lacking MOB1 plus TAZ developed more aggressive invasive SCC than did mice lacking MOB1 alone. This result indicates that YAP1 and TAZ may be activated independently in the SCC context and that the mechanism by which MOB1A/B regulates YAP1 differs from its effects on TAZ in these malignancies. Further study will be required to understand and distinguish between the underlying molecular mechanisms. Nevertheless, our data imply that selective targeting of YAP1 may be an effective new mode of OSCC treatment.

Two TAM-inducible epidermal SCC models have been previously described. In the first model, the mutant mice bear a K-Ras transgene and an inducible Tp53 KO gene (34). Half of these mutants develop skin SCCs by 35 weeks after TAM. In the second model, the mice bear an AKT transgene and an inducible Tp53 KO gene, leading to HNSCC development in 50% of animals by 35 weeks after TAM (35). Thus, we were greatly surprised to observe CIS in the tongue as early as 1 week after TAM in our tgMob1DKO mutants, followed by the inevitable development of invasive SCC by 4 weeks after TAM. Considering that it takes more than 7 days to completely inhibit MOB1 protein expression (fig. S1C), it seems that Mob1a/b-deficient keratinocytes (which bear disruption of a single pathway) may become cancerous immediately without undergoing any other molecular alterations. Our mutant mice thus currently constitute the worlds fastest spontaneous cancer onset model. Moreover, cancer progression is synchronized in all these mutants, and the tumors are easily visualized on the mouse exterior. These characteristics make our model a particularly attractive tool for cancer research and the development of new anticancer drugs. This latter point is a pressing issue because, in the past, several dose-intensified chemo/radiotherapy trials were conducted for HNSCC treatment but quickly reached the limit of human tolerance, showing positive results for only a few select patients (3). Furthermore, recurrent and metastatic HNSCCs are refractory to both conventional chemotherapies and currently available molecular targeting drugs such as EGFR inhibitor (cetuximab) or anti-PD1 antibody (nivolumab), which only marginally improve patient survival (4). Our work has shown that inhibition of YAP1 not only prevents the onset of OSCC but also slows its progression. YAP1 may thus be an appealing molecular target for therapy of this devastating disease. We expect to use our mutant mice to identify new drugs targeting the Hippo pathway in epidermal cancers, including in HNSCCs, with the goal of bringing concrete benefits to patients.

Previously established mouse strains used in this study were Mob1aflox/flox; Mob1b/ (17), Rosa26-CreERT (The Jackson Laboratory), and Tazflox/flox (provided by J. Wrana). Yap1flox/flox mice were generated using Yap1flox/flox embryonic stem cells from the Knockout Mouse Project Repository (36). All mice were kept in specific pathogenfree facilities at Kobe and Kyushu Universities.

Human tongue SCC cell lines HSC3, HSC4, and SCC4 (all from the Japanese Collection of Research Bioresources); SCC9 and Cal27 (both from the American Type Culture Collection); WSU-HN30 (provided by S. Gutkind, University of California); and H1299-Luc (established by H.H.) were cultured in Eagles minimum essential medium, Dulbeccos modified Eagles medium (DMEM), DMEM/Hams F12 medium, or RPMI medium, respectively, supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin-streptomycin at 37C in a 5% CO2/95% air incubator. Hydrocortisone (400 ng/ml) was added to the medium of SCC4 and SCC9 cultures, in line with a standard protocol.

Mob1a/b homozygous double-mutant mice (Rosa26-CreERT; Mob1aflox/flox; Mob1b/) were generated by mating Rosa26-CreERT Tg mice with Mob1aflox/flox; Mob1b/ mice. Rosa26-CreERT Tg mice were in a C57BL/6 background, and Mob1aflox/flox; Mob1b/ mice were backcrossed to C57BL/6 for more than six generations. To delete the floxed Mob1a gene, TAM (Sigma-Aldrich) diluted in 100% ethanol (10 mg/ml) was applied daily directly to the mouse tongue for 5 days by brush. The area of application is indicated in fig. S1A. Before TAM application, mice were anesthetized with a mixture of medetomidine hydrochloride, midazolam, and butorphanol. Mob1aflox/flox; Mob1b/ mice treated with TAM were used as controls unless otherwise stated. Rosa26-CreERT; Mob1aflox/flox; Mob1b/; Yap1flox/flox and Rosa26-CreERT; Mob1aflox/flox; Mob1b/; Tazflox/flox mice were generated by mating Rosa26-CreERT; Mob1aflox/flox; Mob1b/ mice with Yap1flox/flox or Tazflox/flox mice, respectively.

The primers used for mouse genotyping polymerase chain reaction were as follows: Mob1awt/flox, GTCTCGTGAAGGGTCTTGAGG/CCTGGTTGGGGTGGAGAATCAA [wt, 319 base pairs (bp); flox, 450 bp]; Mob1a, GTAATGTGTTCAGCTATGCTTTGAC/CCTGGTTGGGGTGGAGAATCAA (551 bp); Mob1bwt, CTTCAGGATCCTTGGTGGTTATCAG/AGAGCAAGGGGAAAAGAAGCTCAATG (586 bp); Mob1bmutant, CTTCAGGATCCTTGGTGGTTATCAG/TCAGGGTCACAAGGTTCATATGGTG (673 bp); Rosa26-CreERT Tg, AAAGTCGCTCTGAGTTGTTAT/CCTGATCCTGGCAATTTCG (825 bp); Yap1wt/flox, GCCCAAACATACCCACGTAAT/CAGTCCAGTCAAGACAAGAT (wt, 192 bp; flox, 336 bp); Tazwt/flox, AAGCAGTTTCCACTTCATGAAAC/AGTCAAGAGGGGCAAAGTTGTGA (wt, 250 bp; flox, 330 bp).

Tumor tissues were fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) and embedded in paraffin. Sections (4 m) of tumors were cut for hematoxylin and eosin (H&E) staining. Diagnoses of tongue epithelial dysplasia, CIS, or invasive SCC were confirmed by two pathologists.

Primary tongue epithelium from 3-week-old Rosa26-CreERT; Mob1aflox/flox; Mob1b/ mice without TAM was obtained using a dermal keratinocyte isolation protocol (37). Briefly, resected tongue tissues were placed into ice-cold dispase digestion buffer [250 U of dispase (Godo Shusei) in PBS] and incubated overnight at 4C. The epidermis was slowly separated from the dermis using forceps and floated on trypsin solution (Gibco) at room temperature for 40 min to create a primary tongue epithelial cell suspension. Tongue epithelial cells were cultured in CnT-PR medium (CELLnTEC) and passaged more than 40 times to generate the iMob1DKO tongue epithelial cell line. Loss of Mob1a/b in these cells in vitro was induced by treating them with TAM (0.5 M; Toronto Research Chemicals) for 3 days.

Immunoblotting was carried out using a standard protocol and primary antibodies recognizing MOB1A (#E1N9D; Cell Signaling Technology), MST1 (#3682S; Cell Signaling Technology), LATS1 (C66B5; Cell Signaling Technology), YAP1 (#4912S; Cell Signaling Technology), pYAP1(S127) (#4911S; Cell Signaling Technology), TAZ (V386; Cell Signaling Technology), pTAZ (S89) (#75275; Cell Signaling Technology), CTGF (L-20; Santa Cruz Biotechnology), BIRC5 (71G4B7; Cell Signaling Technology), TOP2A (EP1102Y; Abcam), or TP63 (4A4; Abcam). Primary antibodies were detected using horseradish peroxidase (HRP)conjugated secondary rabbit antibody (#7074; Cell Signaling Technology). Endogenous GAPDH (FL-355; Santa Cruz Biotechnology) was used as the internal control. Quantification of signal intensity was performed using Fujifilm Multi Gauge software.

Mice tongue tissues were fixed in 4% PFA, embedded in paraffin, and sectioned (4 m) using standard procedures. IHC or IF staining was performed using an indirect method using primary antibodies recognizing YAP1 (WH0010413M1; Sigma), Ki67 (ab15580; Abcam), or TP63 (4A4; Abcam). Primary antibodies were detected using REAL EnVision HRP-rabbit/mouse (Dako) or Alexa Fluor 568 (Molecular Probes). Some slides were counterstained with Mayers hematoxylin (Muto) or 4,6-diamidino-2-phenylindole (DAPI; Dojindo) before mounting using PermaFluor (Thermo Scientific). For Ki67 positivity studies, 200 cells per mouse were examined.

From the population of patients who were treated at the National Hospital Organization Kyushu Cancer Center in Japan from 2008 to 2013, we selected 86 patients who had received surgical resection of tongue SCC as their first line of therapy and performed a retrospective review of their medical charts. Their resected cancer tissues (n = 86), which had been fixed in formalin, were stained with antibodies recognizing: YAP1 (WH0010413M1; Sigma), TP53 (DO7; Sigma), CTGF (ab6992; Abcam), BIRC5 (EP2880Y; Abcam), or TOP2A (TOP2A/1362; Abcam). Within these stained resected tissues, areas of NT epithelium, dysplasia, CIS, or invasive SCC were determined and levels of YAP1 activity (grade) were scored. YAP1 grade was defined by multiplying the YAP1 frequency score by the YAP1 intensity score, as previously described (38). A score of >8 classified a sample into the YAP1-high group.

To compare overall survival and relapse-free survival rates between groups of patients with high (n = 14) or low (n = 72) YAP1 expression, Kaplan-Meier curves were generated and a Wilcoxon test was used to analyze statistical differences. Overall survival was calculated on the basis of the length of time between date of surgery and date of death. Follow-up duration was 68.1 months on average (range of 3 to 128 months).

To investigate factors influencing YAP1 activity, the following clinicopathological factors were included in the univariate analyses: age, sex, history of smoking, history of alcohol, T stage (which describes the primary tumor size and site), N stage (which describes the degree of regional lymph node involvement), clinical stage, recurrence, degree of tumor differentiation, presence of multiple cancers, and TP53 mutation status [defined as previously described (39)] (see table S1). Univariate analyses were performed using the chi-square test.

siRNA targeting of YAP1, TP53, PTEN, FAT1, or NF2 expression was performed using siRNA oligonucleotides of the following sequences: si-scramble #1, CGUACGCGGAAUACUUCGA; si-scramble #2, UUCUCCGAACGUGUGUCACGU; si-scramble #3, siNC1 (Ambion); si-YAP1 #1, GGCCCUUUGAUUUAGUAUA; si-TP53 #1, GUAAUCUACUGGGACGGAA; si-TP53 #2, GAAAUUUGCGUGUGGAGUA; si-TP53 #3, GGUGAACCUUAGUACCUAA; si-PTEN #1, GCAUACGAUUUUAAGCGGA; si-PTEN #2, CACCGCAUAUUAAAACGUA; si-PTEN #3, CAAGAAAUCGAUAGCAUUU; si-FAT1 #1, GGACCGAAAUUCCUUCGAA; si-FAT1 #2, CGGAAGUUAUCGUUCCGAU; si-FAT1 #3, GACCGAAAUUCCUUCGAA; si-NF2 #1, CAAGCACAAUACCAUUAAA; si-NF2 #2, CCCAAGACGACGUUCACCGUGA; si-NF2 #3, AGAAGCAGAUUUUAGAUGA; si-TP63#1, GAACCGCCGUCCAAUUUUA; and si-TP63#2, UGAUGAACUGUUAUACUUA.

Transfection of siRNA oligonucleotides (10 nM) into exponentially growing WSU-HN30 tongue cancer cells was performed using Lipofectamine RNAiMAX (Invitrogen) following the manufacturers protocol. At 96 hours after transfection, protein lysates were subjected to immunoblotting and cells were IF-stained to detect YAP1 as described above.

WSU-HN30 cells (2 105) were seeded in six-well plates. After 48 hours, EGF (1 g/ml; PeproTech) was added to the culture medium and cells were incubated for 24 hours before harvesting. Immunoblotting and IF staining to detect YAP1 were conducted as described above.

To determine the in vitro effects of drugs known to target YAP1, HSC4 cells (1 104 per well in 24-well plates) were cultured for 1 to 3 days in DMEM/Hams F12 medium containing 5 M dasatinib (Abcam), 5 M verteporfin (USP), 5 M simvastatin (TCI), or vehicle (DMSO; negative control). Inhibition of cell growth was assessed by counting cell numbers per well.

To determine the in vivo effects of dasatinib and simvastatin on the initiation and progression of tongue cancer in tgMob1DKO mice, dasatinib (5 mg/kg, intraperitoneally), simvastatin (50 mg/kg, intraperitoneally), or vehicle (DMSO; negative control) was administered daily for 14 to 17 days starting either 3 days before TAM application (for Fig. 4A) or after CIS onset starting at 2 weeks after TAM (for Fig. 4J).

To determine the effect of YAP1 silencing in vivo, human tongue SCC cells (HSC4; 1 107) that had been transfected with Dox-dependent shYAP1 were injected subcutaneously into the flanks of 9-week-old female BALB/cAJcl-nu/nu mice (CLEA Japan). After visual detection of tumors (usually at 10 days after injection), mice were supplied with normal drinking water or water containing Dox (2 mg/ml). To determine the in vivo effects of dasatinib on human tongue SCC cells, nontransfected HSC4 cells (1 107) were injected subcutaneously into nude mice as above. After visual detection of tumors (usually at 10 days after injection), mice were treated daily with dasatinib (5 mg/kg, intraperitoneally) or vehicle (DMSO; negative control). In both cases, tumor volumes were measured every 4 days using calipers.

Unless otherwise indicated, all results represent the mean SEM. Statistical comparisons between different groups were performed using the two-tailed Students t test. For all statistical analyses, differences of P < 0.05 were considered statistically significant. All experiments were repeated at least three times.

Animal experiments were approved by the Kobe University (#P170604) and Kyushu University (#28-156) Animal Experiment Committees, and the care of the animals was in accordance with institutional guidelines. All clinical samples were approved for analysis by the Ethics Committee at the National Hospital Organization Kyushu Cancer Center (#2015-43). Written informed consent was obtained from all patients whose cancers were analyzed in this study.

Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/12/eaay3324/DC1

Supplementary Materials and Methods

Table S1. Clinicopathological features of 86 cases of human tongue squamous cell carcinoma.

Fig. S1. Induction of Mob1a/b deletion in tgMob1DKO mice by postnatal application of TAM.

Fig. S2. Cell-cell junction collapse and retained cell size of iMob1DKO cells and YAP1/TAZ expression and localization in tongue epithelium of tgMob1DKO, tgYap1TKO, and tgTazTKO mice.

Fig. S3. Effects of dasatinib, simvastatin, verteporfin, and Y-27632 on YAP1 protein expression and activation and tumor-suppressive effect of simvastatin.

Fig. S4. YAP1 expression in OSCC cell lines, the effect on an OSCC cell line of YAP1 depletion combined with cisplatin, and the effect of dasatinib on cell death in tgMob1DKO mice.

Fig. S5. YAP1 target gene expression correlates with YAP1 nuclear expression in human clinical OSCC specimens.

Fig. S6. Evaluation of gene knockdown and ectopic gene expression in the WSU-HN30 HNSCC cell line and activation of YAP1 by knockdown of TP53, PTEN, or FAT1.

Fig. S7. Activation of YAP1 target gene expression by molecules that are frequently altered in human OSCC.

Fig. S8. Positive correlation of Np63 protein expression with YAP1 protein expression.

Fig. S9. Graphical abstract and microarray analysis of growth factors and receptors whose mRNAs are up-regulated in tgMob1DKO tongue epithelial cells.

References (40, 41)

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.

Acknowledgments: We thank H. Togashi, Y. Shimono, and K. Okada (all of Kobe University) for expert technical assistance and critical discussions. We thank J. Wrana (Lunenfeld-Tanenbaum Research Institute) for Tazflox/flox mice and J. S. Gutkind (University of California) for WSU-HN30 cells. Funding: We are grateful for the funding provided by the Japanese Society for the Promotion of Science (JSPS; grants 17H01400, 26114005, and 26640081 to A.S.); the Cooperative Research Project Program of the Medical Institute of Bioregulation, Kyushu University; Nanken-Kyoten, Tokyo Medical and Dental University (TMDU); the Project for Development of Innovative Research on Cancer Therapeutics (P-DIRECT; grant 11088019 to A.S.); the Japanese Agency for Medical Research and Development [P-CREATE (AMED); grant JP19cm0106114 to A.S.]; the Uehara Memorial Foundation (to A.S.); the Shinnihon Advanced Medical Research Foundation (to A.S.); the Daiichi-Sankyo Scholarship Donation Program (to A.S.). Author contributions: Conceptualization: H.O., M.N., T.M., and A.S.; analysis: H.O., M.N., T.M., Y.M., F.U., T. Nakano, and K.T.; resources: H.H., H.N., T.K., and M.M.; data curation: T. Nakano, K.S., K.M., and H.T.; writing of the original draft: H.O., T.M., and A.S.; supervision: M.M., K.M., T.W.M., K.N., and T. Nakagawa; project administration: T.M. and A.S.; funding acquisition: A.S. Competing interests: The authors declare that they do not have competing interest. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Go here to see the original:
YAP1 is a potent driver of the onset and progression of oral squamous cell carcinoma - Science Advances

Can hybrid embryos save the white rhinos from extinction? – Science 101

The northern white rhino population is in jeopardy

The northern white rhino is one of the animal kingdoms many majestic giants, but years of poaching has taken a toll on their population. From 1970 to 1980, their numbers plummeted from 500 to 15 as illegal hunters pursued white rhinos for the ivory of their horns.

Things started to turn around during the 1990s and 2000s, groups and individuals began to crack down on poachers within the white rhinos range. As a result, the population of white rhinos in the wild recovered slightly, peaking at around 32 individuals.

Since 2003, the rate of white rhino poaching has been on the rise and has affected the animals numbers. As of 2008, northern white rhinos have been declared extinct in the wild, and in 2018, the last male northern white rhino died. Now, there are only two of these magnificent beasts left on Earth. Both of them are females.

Najin and Fatu are the last two northern white rhinos in existence. They live at the Ol Pejeta Conservancy in Kenya, and they could be the species last hope for the future. In 2014, keepers in the Czech Republic collected sperm samples from a male northern white rhino living in their care.

Those samples were frozen and stored, and later, they were used in an attempt to breed Najin and Fatu. Both attempts at inducing pregnancies in the two female rhinos were unsuccessful, forcing scientists to consider new methods of approach for saving the white rhinos from extinction.

Typically, when a species is placed on the endangered list, a recovery plan is established by whatever local conservancy group oversees the population. From there, breeding programs of captive individuals are used to begin bolstering the number of individuals on the planet.

When healthy breeding populations have been established, in most cases, reintroduction begins. Small populations of the species are released into the wild to begin repopulation. However, in the case of the northern white rhinos, scientists and conservationists alike have been stuck at step two for decades.

Unwillingness and inability to breed arent uncommon among captive species and individuals, and in most cases, zoos can jockey animals around until a pair matches and produces offspring. In the case of Najin and Fatu, the options for procreation are far more limited. Even the fallback of artificial insemination isnt working for them, so what are scientists to do?

Weve revived entire species from the dead before, but it has never been an easy task. Fortunately, the world of reproductive sciences has been evolving quickly, and conservationists and animal experts now have myriad options to choose from when it comes to creating new life.

Neither surviving female is healthy enough to birth live young. Aside from that, there is the added challenge of finding an option that preserves the northern white rhino genome while maintaining high enough levels of viability.

One possible route to repopulation involves approaching conventional methods from a new and enlightened angle. Although neither Najin nor Fatu can bear young, they both still produce viable egg cells, which can be harvested, frozen, and kept in a lab.

Much like humans undergoing fertility therapy or other conception aids, the grandmother-granddaughter pair or northern white rhinos can hope for success through in-vitro fertilization. This method of conception combines sperm and multiple egg cells in an external environment before implanting them in a host mother.

By using multiple eggs during the in-vitro process, the chances for success, even in females with fertility issues, is significantly increased. In some fortunate cases, the method is so effective, and it results in multiple pregnancies. Once the sperm has fertilized the eggs, the cells are transferred to a living host.

While Najin and Fatu may not be the physical mothers of any of their calves, modern reproductive science has made it possible for their genes to be passed on to another generation.

How? with modern science, a surrogate mother from the thriving population of southern white rhinos could become the mother to their children.The two types of animals have similar enough reproductive organs and their eggs could be used in place of Najin or Fatus.

While the animals are compatible, gathering eggs from them is a far more complicated procedure.

Researchers working on bringing back the northern white rhinos have managed to gather a few eggs so far, but not nearly enough to repopulate an entire species.

Its no secret that rhinoceroses are large animals. Just as cattle and horses have significantly larger hearts than we humans do, rhinos have much larger reproductive organs. Locating and withdrawing eggs from a rhinos ovaries is a far greater ordeal than it is for humans.

To complicate matters further, the ovaries of a southern white rhino are located three to four feet from her rump, and the veterinarian seeking to collect the eggs must guide a probe that distance up her rectum and into an ovary before using a catheter to remove the eggs.

The procedure is anything but easy. In addition to the difficulty involved in the process of extracting eggs, the success rate of current methods is hardly ideal. Researchers working on bringing back the northern white rhinos have managed to gather a few eggs so far, but not nearly enough to repopulate an entire species.

The odds of reestablishing a sustainable population of northern white rhinos through in-vitro fertilization and surrogacy currently seem pretty slim. Fortunately for the rhinos, science has a few other methods up its sleeve.

In the last decade, stem cell research has gone from a thing of whimsy to an advanced field of study that continues to improve by leaps and bounds with every passing year. Its applications are seemingly endless, and they just might be the answer that the northern white rhino conservationists have been looking for.

Stem cells are sort of like biological canvases. They come in different varieties: Totipotent, pluripotent, multipotent, oligopotent, and unipotent. Each of these types has unique limitations and can be found in various sources from embryonic tissue to adult bone marrow.

To make baby rhinos, scientists have been focused on induced pluripotent stem cells, which are gathered and grown from the skin of adult white rhinos

A cell from your bicep and a cell from your gametes (sperm or egg) both hold the same blueprints; they just come in different packaging.

Pluripotent cells behave similarly to embryonic stem cells, which can be coaxed into becoming just about any other type of cell. In this case, even though the original cells were taken from the skin of adult rhinos, they can be trained to become something different, such as egg cells.

Using what knowledge we currently have of stem cells and their manipulation, scientists can tell a northern white rhinos skin cell to become a viable egg or sperm cell. From there, they can attempt in-vitro fertilization and implantation into a surrogate, even without fertile parents.

The method is still in its infancy, but it has been successfully carried out more than once.

With stem cells as a backup and surrogates abound, Najin and Fatu have plenty of options. In late 2019, conservationists and rhinos alike received promising news. Eggs gathered from the two northern white rhinos had been fertilized and resulted in successful embryos. Those embryos were frozen in liquid nitrogen and prepared for a long journey.

Waiting down in southern Africa are the lucky mamas who will become the surrogates for the next generation of northern white rhinos. The embryos have quite a ways to travel before they can be implanted. After that, they can grow within their new mother for the 16 to 18-month gestation period typical of white rhinos.

Although the methods of creating viable embryos are currently long, challenging, and not terribly efficient, these babies-to-be are incredibly promising first steps. In addition to the two successful in-vitro attempts in September, December of 2019 saw the creation of a third viable embryo.

2020 will undoubtedly see further attempts at creating more embryos. With luck, we can soon hope to hear news of successful implantations in surrogate moms. In 2021, we can throw a worldwide baby shower for some bouncing baby northern white rhinos, whose births will serve as a beacon of hope for a dying species.

Here is the original post:
Can hybrid embryos save the white rhinos from extinction? - Science 101

Autologous Stem Cell Based Therapies Market 2020: Potential Growth, Challenges, Attractive Valuation | Key Players: Anterogen, Holostem Advanced…

Global Autologous Stem Cell Based Therapies Market Report is a professional and in-depth research report on the worlds major regional market conditions of the Autologous Stem Cell Based Therapies industry, focusing on the main regions and the main countries (United States, Europe, Japan and China).

Market Segmentations: Global Autologous Stem Cell Based Therapies market competition by top manufacturers, with production, price, revenue (value) and market share for each manufacturer.

Based on type, report split into Embryonic Stem Cell, Resident Cardiac Stem Cells, Umbilical Cord Blood Stem Cells.

Based on the end users/applications, this report focuses on the status and outlook for major applications/end users, consumption (sales), market share and growth rate for each application, including Neurodegenerative Disorders, Autoimmune Diseases, Cardiovascular Diseases.

The report introduces Autologous Stem Cell Based Therapies basic information including definition, classification, application, industry chain structure, industry overview, policy analysis, and news analysis. Insightful predictions for the Autologous Stem Cell Based Therapies Market for the coming few years have also been included in the report.

Autologous Stem Cell Based Therapies Market landscape and market scenario includes:

The Autologous Stem Cell Based Therapies industry development trends and marketing channels are analyzed. Finally, the feasibility of new investment projects is assessed, and overall research conclusions offered.

ENQUIRE MORE ABOUT THIS REPORT AT https://inforgrowth.com/enquiry/4403641/autologous-stem-cell-based-therapies-industry-mark

CHAPTERS COVERED IN THIS REPORT ARE AS FOLLOW:

Get Special Discount Up To 50%, https://inforgrowth.com/discount/4403641/autologous-stem-cell-based-therapies-industry-mark

FOR ALL YOUR RESEARCH NEEDS, REACH OUT TO US AT:Address: 6400 Village Pkwy suite # 104, Dublin, CA 94568, USAContact Name: Rohan S.Email:[emailprotected]Phone: +1-909-329-2808UK: +44 (203) 743 1898Website: http://www.inforgrowth.com

Read more from the original source:
Autologous Stem Cell Based Therapies Market 2020: Potential Growth, Challenges, Attractive Valuation | Key Players: Anterogen, Holostem Advanced...