Yearly Archives: 2020


The ‘supercells’ that cured an infant’s grave genetic illness – FRANCE 24

McLean (United States) (AFP)

When a person's immune system is impaired by a genetic disease, a bone-marrow transplant can be a powerful therapeutic tool, but with a major downside: during the first few months the recipient's defenses against viruses are severely weakened. The slightest infection can lead to a hospital trip.

A still-experimental type of treatment known as T-cell therapy aims to assist during this vulnerable period -- the months during which the body is rebuilding its natural defenses. After two decades of clinical trials, the technology has been refined, and is being used to treat more and more patients, many of them children.

A boy named Johan is one of them.

Today he is a mischievous, smiling toddler with a thick shock of light-brown hair, who never tires, playfully tormenting the family's puppy, Henry.

There is no sign of the three-year-long medical and emotional roller-coaster ride he and his family, who live in an affluent Washington suburb, have been on.

The first traumatic surprise came with the results of a pregnancy test: Johan was not planned.

"That was a huge shock. I cried," said his mother, 39-year-old Maren Chamorro.

- Risky procedure -

She had known since childhood that she carried a gene that can be fatal in a child's first 10 years, chronic granulomatous disease (CGD).

Her brother died of it at the age of seven. The inexorable laws of genetics meant that Maren had a one in four chance of transmitting it to her child.

For their first children, she and her husband Ricardo had chosen in-vitro fertilization, allowing the embryos to be genetically tested before implantation.

Their twins Thomas and Joanna were born -- both disease-free -- seven and a half years ago.

But in Johan's case, a post-birth genetic test quickly confirmed the worst: he had CGD.

After conferring with experts at Children's National Hospital in Washington, the couple took one of the most important decisions of their lives: Johan would receive a bone-marrow transplant, a risky procedure but one that would give him a chance of a cure.

"Obviously, the fact that Maren had lost a sibling at a young age from the disease played a big role," Ricardo confided.

Bone marrow, the spongy tissue inside bones, serves as the body's "factory" for the production of blood cells -- both red and white.

- His brother's immune system -

Johan's white blood cells were incapable of fighting off bacteria and fungal infections. A simple bacterial infection, of negligible concern in a healthy child, could spread out of control in his young body.

Luckily, Johan's brother Thomas, six years old at the time, was a perfect match. In April 2018, doctors first "cleansed" Johan's marrow using chemotherapy. They then took a small amount of marrow from Thomas's hip bones using a long, thin needle.

From that sample they extracted "supercells," as Thomas calls them -- stem cells, which they reinjected into Johan's veins. Those cells would eventually settle in his bone marrow -- and begin producing normal white blood cells.

The second step was preventive cell therapy, under an experimental program led by immunologist Michael Keller at Children's National Hospital.

The part of the immune system that protects against bacteria can be rebuilt in only a matter of weeks; but for viruses, the natural process takes at least three months.

- Hurdles remain -

From Thomas's blood, doctors extracted specialized white blood cells -- T-cells -- that had already encountered six viruses.

Keller grew them for 10 days in an incubator, creating an army of hundreds of millions of those specialized T-cells. The result: a fluffy white substance contained in a small glass vial.

Those T-cells were then injected into Johan's veins, immediately conferring protection against the six viruses.

"He has his brother's immune system," said Keller, an assistant professor at Children's National.

Johan's mother confirmed as much: today, when Thomas and Johan catch a cold, they have the same symptoms, and for nearly the same amount of time.

"I think it's pretty cool to have immunity from your big brother," Maren Chamorro said.

This therapeutic approach -- boosting the body's immune system using cells from a donor or one's own genetically modified cells -- is known as immunotherapy.

Its main use so far has been against cancer, but Keller hopes it will soon become available against viruses for patients, like Johan, who suffer from depressed immune systems.

The chief obstacles to that happening are the complexity of the process and the costs, which can run to many thousands of dollars. These factors currently restrict the procedure to some 30 medical centers in the United States.

For Johan, a year and a half after his bone marrow transplant, everything points to a complete success.

"It's neat to see him processing things, and especially play outside in the mud," his mother said.

"You know, what a gift!"

Her only concern now is the same as any mother would have -- that when her son does fall ill, others in the family might catch the same bug.

2020 AFP

More:
The 'supercells' that cured an infant's grave genetic illness - FRANCE 24

How supercells cured an infants grave genetic illness – Raw Story

When a persons immune system is impaired by a genetic disease, a bone-marrow transplant can be a powerful therapeutic tool, but with a major downside: during the first few months the recipients defenses against viruses are severely weakened. The slightest infection can lead to a hospital trip.

A still-experimental type of treatment known as T-cell therapy aims to assist during this vulnerable period the months during which the body is rebuilding its natural defenses. After two decades of clinical trials, the technology has been refined, and is being used to treat more and more patients, many of them children.

A boy named Johan is one of them.

Today he is a mischievous, smiling toddler with a thick shock of light-brown hair, who never tires, playfully tormenting the familys puppy, Henry.

There is no sign of the three-year-long medical and emotional roller-coaster ride he and his family, who live in an affluent Washington suburb, have been on.

The first traumatic surprise came with the results of a pregnancy test: Johan was not planned.

That was a huge shock. I cried, said his mother, 39-year-old Maren Chamorro.

Risky procedure

She had known since childhood that she carried a gene that can be fatal in a childs first 10 years, chronic granulomatous disease (CGD).

Her brother died of it at the age of seven. The inexorable laws of genetics meant that Maren had a one in four chance of transmitting it to her child.

For their first children, she and her husband Ricardo had chosen in-vitro fertilization, allowing the embryos to be genetically tested before implantation.

Their twins Thomas and Joanna were born both disease-free seven and a half years ago.

But in Johans case, a post-birth genetic test quickly confirmed the worst: he had CGD.

After conferring with experts at Childrens National Hospital in Washington, the couple took one of the most important decisions of their lives: Johan would receive a bone-marrow transplant, a risky procedure but one that would give him a chance of a cure.

Obviously, the fact that Maren had lost a sibling at a young age from the disease played a big role, Ricardo confided.

Bone marrow, the spongy tissue inside bones, serves as the bodys factory for the production of blood cells both red and white.

His brothers immune system

Johans white blood cells were incapable of fighting off bacteria and fungal infections. A simple bacterial infection, of negligible concern in a healthy child, could spread out of control in his young body.

Luckily, Johans brother Thomas, six years old at the time, was a perfect match. In April 2018, doctors first cleansed Johans marrow using chemotherapy. They then took a small amount of marrow from Thomass hip bones using a long, thin needle.

From that sample they extracted supercells, as Thomas calls them stem cells, which they reinjected into Johans veins. Those cells would eventually settle in his bone marrow and begin producing normal white blood cells.

The second step was preventive cell therapy, under an experimental program led by immunologist Michael Keller at Childrens National Hospital.

The part of the immune system that protects against bacteria can be rebuilt in only a matter of weeks; but for viruses, the natural process takes at least three months.

Hurdles remain

From Thomass blood, doctors extracted specialized white blood cells T-cells that had already encountered six viruses.

Keller grew them for 10 days in an incubator, creating an army of hundreds of millions of those specialized T-cells. The result: a fluffy white substance contained in a small glass vial.

Those T-cells were then injected into Johans veins, immediately conferring protection against the six viruses.

He has his brothers immune system, said Keller, an assistant professor at Childrens National.

Johans mother confirmed as much: today, when Thomas and Johan catch a cold, they have the same symptoms, and for nearly the same amount of time.

I think its pretty cool to have immunity from your big brother, Maren Chamorro said.

This therapeutic approach boosting the bodys immune system using cells from a donor or ones own genetically modified cells is known as immunotherapy.

Its main use so far has been against cancer, but Keller hopes it will soon become available against viruses for patients, like Johan, who suffer from depressed immune systems.

The chief obstacles to that happening are the complexity of the process and the costs, which can run to many thousands of dollars. These factors currently restrict the procedure to some 30 medical centers in the United States.

For Johan, a year and a half after his bone marrow transplant, everything points to a complete success.

Its neat to see him processing things, and especially play outside in the mud, his mother said.

You know, what a gift!

Her only concern now is the same as any mother would have that when her son does fall ill, others in the family might catch the same bug.

then let us make a small request. Like you, we here at Raw Story believe in the power of progressive journalism. Raw Story readers power David Cay Johnstons DCReport, which we've expanded to keep watch in Washington. Weve exposed billionaire tax evasion and uncovered White House efforts to poison our water. Weve revealed financial scams that prey on veterans, and legal efforts to harm workers exploited by abusive bosses. And unlike other news outlets, weve decided to make our original content free. But we need your support to do what we do.

Raw Story is independent. You wont find mainstream media bias here. Unhinged from billionaires and corporate overlords, we fight to ensure no one is forgotten.

We need your support to deepen our investigative reporting. Every reader contribution, whatever the amount, makes a tremendous difference. Invest with us. Make a one-time contribution to Raw Story Investigates, or click here to become a subscriber. Thank you. Click to donate by check.

then let us make a small request. Like you, we here at Raw Story believe in the power of progressive journalism and were investing in investigative reporting as other publications give it the ax. Raw Story readers power David Cay Johnstons DCReport, which we've expanded to keep watch in Washington. Weve exposed billionaire tax evasion and uncovered White House efforts to poison our water. Weve revealed financial scams that prey on veterans, and efforts to harm workers exploited by abusive bosses. We need your support to do what we do.

Raw Story is independent. You wont find mainstream media bias here. Unhinged from corporate overlords, we fight to ensure no one is forgotten.

We need your support to keep producing quality journalism and deepen our investigative reporting. Every reader contribution, whatever the amount, makes a tremendous difference. Invest with us in the future. Make a one-time contribution to Raw Story Investigates, or click here to become a subscriber. Thank you.

Here is the original post:
How supercells cured an infants grave genetic illness - Raw Story

Firm adds a new wrinkle to anti-aging products – Williamson Daily News

HUNTINGTON Serucell Corporation, a cosmeceutical company based in Huntington, has developed the worlds only dual-cell technology to create and produce anti-aging skincare products, and they did it in Huntington.

Serucell KFS Cellular Protein Complex Serum is made start to finish at Serucells laboratory on the south side of Huntington.

This has been one of the best kept secrets in West Virginia, said Cortland Bohacek, executive chairman and a co-founder of Serucell Corporation.

The company soft launch was in September 2018 at The Greenbrier Spas. The Official online launch was April 2019 and is getting exposure with some well known sellers like Neiman Marcus, local dermatologist and plastic surgeons offices and several other retail locations from New York to California. It is also sold online at serucell.com.

One person that has tried the product is Jennifer Wheeler, who is also a Huntington City Council member.

As a consumer I have an appreciation of the quality of the product and the results Ive seen using it, she said. It has been transformative for my skin and seems like its success will be transformative for our city as well.

She said Serucell and the people behind it are impressive on every level.

In my role on council, Im especially grateful for the companys conscious effort to stay and grow in our city, Wheeler said.

A one-ounce bottle of the serum costs $225. The recommended usage is twice per day and it will last on average of about six weeks.

Serucells active ingredient is called KFS (Keratinocyte Fibroblast Serum), which is made up of more than 1,500 naturally derived super proteins, collagens, peptides and signaling factors that support optimal communication within the cellular makeup of your skin.

This is the first and only dual-cell technology that optimizes hydration and harnesses the power of both keratinocytes and fibroblasts, two essential contributors to maintaining healthy skin by supporting natural rejuvenation of aging skin from the inside out, said Jennifer Hessel, president and CEO of the company.

When applied to the skin, KFS helps boost the skins natural ability to support new collagen and elastin, strengthen the connection and layer of support between the upper and lower layers of your skin. The result, over time is firmer, plumper and smoother skin, according to Hessel.

Why it works so naturally with your skin is because it is natural, Hessel said. These proteins play an important role in strengthening the bond between the layers of your skin, and thats where the re-boot happens.

KFS is the creation of Dr. Walter Neto, Serucells chief science officer and co-founder of the company. Neto is both a physician and a research scientist, specializing in the field of regenerative medicine with an emphasis on skin healing and repair.

Neto said Serucells technology unlocks the key to how our cells communicate and harnesses the signaling power actions to produce the thousands of bioactive proteins necessary to support the skins natural rejuvenation.

Originally from Brazil, Neto studied at Saint Matthews University and completed his clinical training in England. His clinical research on stem-cell cancer therapies, bone and tissue engineering and wound and burn healing led to his discovery in cell-to-cell communication, and ultimately the creation of Serucells KFS Cellular Protein Complex Serum.

Neto received multiple patents for the production method of Serucell KFS Serum. He lives in Huntington with his wife and four golden retrievers and works alongside his longtime friend, Dr. Brett Jarrell.

I have known Brett since I was 18 years old, Neto said.

Jarrell practices emergency medicine in Ashland, Kentucky, and oversees all aspects of quality control for Serucell. He received his bachelors degree in biology from Wittenberg University, his masters degree in biology from Marshall University and his medical degree from the Marshall University School of Medicine. Jarrell completed his residency at West Virginia University and is board certified by the American Board of Emergency Medicine.

Jarrell has served as a clinical instructor of emergency medicine at the Marshall School of Medicine, president of the West Virginia chapter of the American College of Emergency Medicine and he has published a number of peer-reviewed journal articles on stroke research.

Jarrell also lives in Huntington.

Another co-founder of the company is Dr. Tom McClellan.

McClellan is Serucells chief medical officer and director of research and is a well-respected plastic and reconstructive surgeon with a private practice, McClellan Plastic Surgery, in Morgantown.

McClellan completed his plastic and reconstructive surgery training at the world-renowned Lahey Clinic Foundation, a Harvard Medical School and Tufts Medical School affiliate in Boston, Massachusetts. While in Boston, he worked at Lahey Medical Center, Brigham and Womens Hospital, as well as at the Boston Childrens Hospital. McClellan is board certified by the American Board of Plastic Surgery.

In addition to his practice and role at Serucell, McClellan utilizes his surgical skills through pro bono work with InterplastWV, a non-profit group that provides comprehensive reconstructive surgery to the developing world. He has participated in surgical missions to Haiti, Peru and the Bahamas.

McClellan lives in Morgantown with his family.

All three doctors here have strong connections to West Virginia, and we didnt want to leave, Neto said. We all want to give back to West Virginia, so that is the main reason we have our business here in Huntington.

We are building a company we believe can make a difference in the community, Hessel added. Our goal is to grow Serucell and build our brand right here in Huntington. There is a pool of untapped talent here in Huntington. When we expand our business here, we can provide another reason for young people to be able to stay and grow their careers, whether it is in science, operations or manufacturing. The team is a pretty excited to make an impact in the community where it all started.

Hessel decline to give sales numbers, but said the business has been growing each year since the product was introduced. She also declined to give the number of employees at the facility, but did say it has sales representatives across the country.

Visit link:
Firm adds a new wrinkle to anti-aging products - Williamson Daily News

First Edition: January 3, 2020 – Kaiser Health News

Today's early morning highlights from the major news organizations.

Kaiser Health News:Grade A All-American Pot: The Next Big Export?In a large warehouse, LivWell Enlightened Health feeds its cloned cannabis plants a custom blend of nutrients, sprays them with filtered water and pumps extra carbon dioxide into the air. LivWell releases three types of insects to clear the plants of unwanted pests without the use of toxic pesticides. Every part of the growing process is meticulously documented and evaluated to constantly refine the process. (Hawryluk, 1/3)

Kaiser Health News:One-On-One With Trumps Medicare And Medicaid Chief: Seema VermaSeema Verma, administrator for the Centers for Medicare & Medicaid Services, sat down for a rare one-on-one interview with Kaiser Health News senior correspondent Sarah Varney. They discussed her views on President Donald Trumps plan for sustaining public health insurance programs, how the administration would respond if Obamacare is struck down by the courts in the future and her thoughts on how the latest Medicare for All proposals would affect innovation and access to care. (Varney, 1/3)

Kaiser Health News:Watch: Behind The Troubling Rise Of Uninsured American KidsMore than a million fewer children receive public health insurance now than in December 2017. In some cases, their parents acquired coverage at work. But researchers also see a troubling rise in uninsured children and say the Trump administrations policies are partially to blame. (Varney, 1/3)

Kaiser Health News:KHNs What The Health?: How Do Other Countries Pay For Health Care?Many proponents of creating a Medicare for All system in the United States say it would make this country more like other industrialized nations. But, in fact, other countries structure their systems in a wide variety of ways. Some have a Medicare for All-type system, with private providers and public payment. But some systems are closer to government-run, while others include large roles for private insurance. (1/2)

Kaiser Health News:Watch: Woman Hit With $28K Bill For A Throat SwabA routine doctors visit for a sore throat brought more than $28,000 in charges for one New York City woman in our latest Bill of the Month installment. David Begnaud of CBS This Morning, in partnership with NPR and Kaiser Health News, discussed the case with KHN Editor-in-Chief Elisabeth Rosenthal in the Dec. 31 broadcast. (1/2)

The Washington Post:Sales Of Mint- And Fruit-Flavored E-Cigarette Pods To End By Early FebruaryThe Food and Drug Administration on Thursday ordered companies to stop manufacturing, distributing and selling most cartridge-based e-cigarette flavors including mint and fruity flavors by early February, saying the crackdown is urgently needed to stem a surge in teen vaping. The deadline was announced as the Trump administration officially unveiled its long-debated vaping policy. (McGinley, 1/2)

Los Angeles Times:Softer Trump Vaping Ban Replaces Strict Ban On All FlavorsThe new ban does not extend to refillable, tank-based vaping systems purchased in most vape shops, which users can fill with flavored e-liquid. It also excludes menthol-flavored cartridges. Together, the two exemptions represent a major retreat from an earlier White House plan to bar all flavors other than tobacco. The new policy will also leave Juul, the leading e-cigarette among teens, largely untouched. The company suspended nationwide sales of sweet flavors like mango and cucumber in October, then added mint to the list in November. It still sells menthol pods. (Baumgaertner, 1/2)

Politico:Trump's Dialed-Back Vaping Ban Angers Anti-Tobacco GroupsThe plan delivers relief to free-market advocates and thousands of small vape shops and vape-makers who protested that a sweeping favor ban would shutter their businesses. The measure will largely affect big tobacco companies that make popular vaping pods, though Juul has already pulled many of its products off the shelf. The larger firms can weather the challenge as well as a costly application process with the Food and Drug Administration that is likely to thin out small players from the market over the next few years. (Owermohle, 1/2)

NPR:Trump Administration Cracks Down On Some Flavored Vaping Products"We're striking a balance," Health and Human Services Secretary Alex Azar said during a news conference, explaining that e-cigarettes need to remain an "off-ramp" for adults to transition away from combustible cigarettes, but they can't become an "on-ramp" for children to become addicted to nicotine. Azar stressed that all vape products are currently "illegal" because they are on the market despite not being cleared by the FDA. (Lupkin, 1/2)

The Wall Street Journal:FDA Bars Fruit, Mint Flavors In Vaping Cartridges But Makes Exemption For Vape ShopsE-cigarettes, most of them cartridge based, generate $6.4 billion in annual U.S. sales while tank vaping systems generate $2.6 billion, according to Wells Fargo. Cartridge-based vaporizers such as those made by Juul Labs Inc. are sold in gas stations and convenience stores as well as tobacco and vape shops. Tank-based systems and their accompanying nicotine liquids are sold primarily in vape shops, but are also available online and in some convenience stores. Major retail chains such as Walmart and Walgreens stopped selling all vaping products last year. (Maloney and Burton, 1/2)

The New York Times:With Partial Flavor Ban, Trump Splits The Difference On VapingAround the West Wing, polling data was circulated that had the imprimatur of one of Mr. Trumps pollsters, John McLaughlin, showing that in battleground states, the presidents supporters opposed regulations against vaping. But the poll was commissioned by a vaping industry group, and ultimately, those resisting any crackdown, such as the presidents 2020 campaign manager, Brad Parscale, lost to the advisers who wanted to keep flavored e-cigarettes away from young people. (Goodnough, Haberman and Kaplan, 1/2)

Reuters:Trump Administration Restricts Some E-Cigarette FlavorsRepresentative Frank Pallone, the Democratic chair of the U.S. House of Representatives Energy and Commerce Committee, which has launched probes into e-cigarette manufacturers, dismissed the impact of the ban. "A flavor ban that exempts menthol and vape shops is no ban at all," Pallone tweeted. (Kirkham, 1/2)

The Associated Press:Trump's Plan To Curb Teen Vaping Exempts Some FlavorsAnti-tobacco advocates immediately condemned the decision to permit menthol and exempt tank-based vapes, accusing the administration of caving to industry pressure. Its disturbing to see the results of industry lobbying to undermine public health protections, especially the lives and health of our youth, said American Lung Association President and CEO Harold Wimmer. The association and other health groups argue that teenagers who vape will simply shift to using menthol if it remains on the market. (Perrone, 1/2)

The Washington Post:D.C. Council Weighs Banning Flavored E-Cigarettes And Menthol CigarettesAnti-tobacco advocates on Thursday urged the D.C. Council to add menthol cigarettes to its list of banned items as lawmakers consider prohibiting all flavored vaping products in the nations capital. The testimony came during a five-hour hearing on bills meant to rein in youth vaping and the rise of electronic cigarettes. But advocates also revived a decades-old fight over menthol cigarettes, a minty flavor disproportionately marketed to and used by African Americans. (Nirappil, 1/2)

The Associated Press:Smokers, Do Not Apply: U-Haul Won't Hire Some Nicotine UsersU-Haul has a New Year's resolution: Cut down on hiring people who smoke. The moving company said that it won't hire nicotine users in the 21 states where it is legal to do so, saying that it wants to ensure a healthier workforce." The new policy will start Feb. 1, and won't apply to those hired before then. (1/2)

The Washington Post:More Than 200 Republican Members Of Congress Urge Supreme Court To Reconsider Roe V. Wade Abortion Rights DecisionMore than 200 members of Congress nearly all of them Republicans on Thursday urged the Supreme Court to reconsider the landmark 1973 Roe v. Wade abortion rights decision, prompting a wave of protests from Democrats and reproductive rights groups. The 207 lawmakers signaled their position in an amicus brief supporting a restrictive Louisiana abortion law that is expected to be reviewed by the Supreme Court on March 4. The 2014 law, which was stayed by the Supreme Court in February, would require doctors at abortion clinics to have admitting privileges at nearby hospitals. (Sonmez, 1/2)

The New York Times:More Than 200 Republicans Urge Supreme Court To Weigh Overturning Roe V. WadeRoughly 80 percent of the Republicans in Congress 39 senators and 166 House members and two centrist House Democrats signed the amicus, or friend of the court, brief in the case of June Medical Services L.L.C. v. Gee. They also asked the justices to consider overturning another landmark abortion ruling in the 1992 case Planned Parenthood v. Casey. The court has exercised that judgment to overrule precedent in over 230 cases throughout its history, the lawmakers wrote. Forty-six years after Roe was decided, it remains a radically unsettled precedent: Two of the seven justices who originally joined the majority subsequently repudiated it in whole or in part, and virtually every abortion decision since has been closely divided. (Stolberg, 1/2)

CNN:Abortion: Lawmakers Ask Supreme Court To 'Reconsider' Roe V. WadeThe Republican brief comes on the heels of nearly 200 congressional Democrats filing a brief last month defending Roe and Louisiana abortion providers. The Louisiana challenge is the first abortion-related case that will be heard since Justices Brett Kavanaugh and Neil Gorsuch took the bench. Supporters of reproductive freedom fear that the case will present the justices with a chance to chip away at abortion rights. (De Vogue and Kelly, 1/2)

CBS News:Republican Senators And Congressmen Ask Supreme Court To Consider Overturning Roe V. WadeJune Medical Services challenged a Louisiana law, passed in 2014 and currently not in effect, which required doctors performing abortions to have admitting privileges at a local hospital within 30 miles of the facility where the abortion is performed. If the law is allowed to be implemented, all of Louisiana's abortion clinics would close, as first reported in October by CBS News. (Segers, 1/2)

NBC News:Over 200 Members Of Congress Ask Supreme Court To 'Reconsider' Roe V. WadeA federal district judge blocked the law in 2017. But in 2018, the 5th U.S. Circuit Court of Appeals upheld it, arguing that the law would not impose an "undue burden," which has been the high court's key legal test for challenges to abortion restrictions. The Supreme Court reimposed the stay in February to weigh its constitutionality, and it said Tuesday that it would hear the case on March 4. (Clark, 1/2)

NPR:To Get An Abortion, Teens In 26 States Must Ask Parent Or JudgeThe teenager was just 15, and recovering from a rape, when she realized she was pregnant. This young woman, whom NPR has agreed not to name, says she knew right away that she wanted to terminate the pregnancy. But like a lot of states, Massachusetts required and still requires minors to get a parent's consent before obtaining an abortion. (Bebinger, 1/2)

The Washington Post:Poll: White Evangelicals Distinct On Abortion, LGBT PolicyWhite evangelical Protestants stand noticeably apart from other religious people on abortion restrictions and LGBT discrimination protections, two of the most politically divisive issues at play in the 2020 presidential election, according to a new poll. The findings point to an evangelical Protestant constituency thats more firmly aligned with President Donald Trumps agenda than other Americans of faith. White evangelicals were also more likely than members of other faiths to say religion should have at least some influence on policymaking. (Schor and Swanson, 1/2)

The Wall Street Journal:Drug Prices Climb By 5.8% On Average, Less Than Last YearPharmaceutical companies started 2020 by raising the prices of hundreds of drugs an average of 5.8%, according to a new analysis, a smaller increase than a year prior as the industry faces growing scrutiny from patients, lawmakers and health plans. Pfizer Inc. led the way, including increasing prices by over 9% on more than 40 products. The drug industry traditionally sets prices for its therapies at the start of the year and again in the middle of the year. (Hopkins, 1/2)

Bloomberg:Drugmakers Hike 2020 Medicine Prices Despite Lawmakers IreSome key drugs, such as Merck & Co.s top-selling cancer drug Keytruda, have yet to see higher prices, according to data compiled by Evercore ISIs Umer Raffat. But last years price increases didnt occur until a few days into the new year, the analyst said. Companies may be delaying some of those increases to later this month to escape early January scrutiny, Bernstein analyst Ronny Gal said in an email. While its too soon to tell, Gal expects price hikes may go up modestly from last year. So far, 85 drugmakers have reported with price increases on over 300 unique drugs, according to 3 Axis analysis. (Flanagan, 1/2)

Stat:It's 'Business As Usual' As Many Drug Makers Boost Prices For The New YearFor instance, Gilead Sciences (GILD) increased prices for several HIV pills by 4.8%, Biogen (BIIB) boosted its Tecfidera multiple sclerosis treatment by 6%, Eli Lilly (LLY) raised the cost of two diabetes medicines by 6%, and Pfizer (PFE) increased the list price of its Prevnar vaccine for pneumococcal disease by 7.3%. Notably, AbbVie (ABBV) boosted the price of its Humira rheumatoid arthritis treatment by 7.4%, and this comes after the company reached deals with several other drug makers to delay competition in the U.S. until 2023. (Silverman, 1/2)

CNN:Best And Worst Diets For 2020, Ranked By ExpertsWho won the 2020 battle of the diets? For the third year in a row, the well-researched Mediterranean diet KO'd the competition to win gold in US News and World Report's 2020 ranking of best diets. The report, released Thursday, is now in its 10th year. (LaMotte, 1/2)

CNN:Intermittent Fasting: Benefits And LimitationsAbstaining from food for 16 to 18 hours a day could be key to treating a variety of health conditions -- even if you've got to train yourself to push past the hunger. A review of past animal and human studies in The New England Journal of Medicine suggests that intermittent fasting can reduce blood pressure, aid in weight loss and improve longevity. (Andrew, 1/2)

The Associated Press:Parents Of Adult Children With Disabilities Fill Housing GapFor caretakers, the inevitable question of where to place their children with disabilities when they are no longer around can be scary and overwhelming. But some are literally breaking new ground in finding an answer. Parents in Arizona, Wisconsin, Maryland and other states have become the architects of their childrens futures. One reason: Social media and online resources are inspiring parents to look beyond the status quo, said Desiree Kameka, director of the nonprofit Autism Housing Network, which maintains a list of U.S. residential opportunities for people with intellectual and developmental disabilities. It shows nearly 50 communities are being developed or are in the planning phase nationwide, including several that are parent-driven. (Tang, 1/3)

NPR:Sickle Cell Patients Are Left In Pain, As Hospitals Cut Back On OpioidsIndia Hardy has lived with pain since she was a toddler from dull persistent aches to acute flare-ups that interrupt the flow of her normal life. The pain is from sickle cell disease, a group of genetic conditions that affect about 100,000 people in the U.S., many of them of African or Hispanic descent. Sitting in the afternoon heat on her mom's porch in Athens, Ga., Hardy remembers how a recent "crisis" derailed her normal morning routine. (Whitehead, 1/2)

NPR:These Women's Health Taboos Are Overdue To Be BustedAs the decade changes and we consider the state of women's health in America, who better to turn to than the authors of five taboo-busting books from 2019 that took on issues that generations of women haven't been talking about, but need to. We asked these outspoken doctors and health advocates to give us their Top 7 messages to women for 2020. Here's what they said. (Vaughn, 1/2)

The Associated Press:Backlog Of Toxic Superfund Clean-Ups Grows Under TrumpThe Trump administration has built up the biggest backlog of unfunded toxic Superfund clean-up projects in at least 15 years, nearly triple the number that were stalled for lack of money in the Obama era, according to 2019 figures quietly released by the Environmental Protection Agency over the winter holidays. The accumulation of Superfund projects that are ready to go except for money comes as the Trump administration routinely proposes funding cuts for Superfund and for the EPA in general. (Knickmeyer, Brown and White, 1/3)

The New York Times:Texas Judge Rules That Hospital Can Take Baby Off Life SupportA Texas judge ruled on Thursday that a hospitals plan to remove an 11-month-old girl from life support over her familys objections could proceed, the latest twist in a case that has drawn notice from conservatives around the state. The child, Tinslee Lewis, was born prematurely and suffers from a rare heart defect and other health issues, according to Cook Childrens Medical Center in Fort Worth, where she had been treated for 11 months. Doctors there had done everything possible to save Tinslees life, but ultimately concluded that they could not do so, the hospital said in a statement. (Zraick, 1/2)

The Wall Street Journal:One-Year-Old Girl Can Be Removed From Life Support, Texas Court RulesCook Childrens Medical Center in Fort Worth told the family of 11-month-old Tinslee Lewis in October that it wouldnt continue treating her because doctors believe she has no chance of recovery and is only suffering, according to a timeline provided by the hospital. Twenty other hospitals and pediatric cardiac specialists also agreed with Cook Childrens assessment and declined to treat Tinslee, according to the hospital. Tinslees family has fought to keep the baby alive with the help of Texas Right to Life, an antiabortion group, and said they plan to appeal Thursdays ruling to another state court. (Findell, 1/2)

The Associated Press:Texas Judge: Hospital Can Remove Baby From Life SupportDoctors at the Fort Worth hospital had planned to remove Tinslee from life support Nov. 10 after invoking Texas 10-day rule, which can be employed when a family disagrees with doctors who say life-sustaining treatment should be stopped. The law stipulates that if the hospital's ethics committee agrees with doctors, treatment can be withdrawn after 10 days if a new provider cant be found to take the patient. (1/2)

The Wall Street Journal:Transit Systems Take On Role As Homeless AdvocatesJeffrey Knueppels skills include running trains, buses and subways, and helping people who are homeless find jobs and housing. The retired general manager of the Philadelphia regions transit authority, like a growing number of transit officials around the country, increasingly assumed a social-welfare role in recent years as his agency struggled to cope with rising homelessness. The Southeastern Pennsylvania Transportation Authority spent more than $1 million partnering with the city of Philadelphia to build an 11,000-square-foot homeless drop-in center at a busy subway station. (Berger, 1/2)

Continued here:
First Edition: January 3, 2020 - Kaiser Health News

Finn the Fabulous to ring treatment bell after leaving hospital – expressandstar.com

The family of Finn the Fabulous were overjoyed to announce that Finley Hill has returned home, and will be ringing the hospital treatment bell, at the beginning of 2020.

The seven-year-old, from Belbroughton, near Stourbridge, was diagnosed with rare immune system disorder familial HLH, which causes damaged and enlarged organs.

Without stem cell treatment he will die.

His mother Jo Hill said she knew Finn still had a mountain to climb but that he had done amazingly well to get to where he was.

She said: We would like to give everyone an extra reason to raise a glass and everyone a little hope, we hope, who may be facing what feels like an impossible battle.

Finn was discharged the day before New Years Eve. He is ringing the bell next Tuesday.

We know neither of these means he doesnt still have a mountain to climb but he has done so brilliantly, so far and should be immensely proud of himself.

We enter this new year at home together, this new decade with a reinforced positivity that this boy can and he will.

Earlier this year, after a lengthy search, a stem cell donor match was found for Finn in the form of a 43-year-old man from Brazil, which gave the family hope.

It meant Finn, a pupil at Hagley Primary, went into hospital in November to undergo gruelling treatment.

Doctors said he would be in hospital for three months, but he returned home just in time to see in 2020.

Jo added: We couldnt be happier. Although we didnt make it to midnight, we all just fell asleep!

Finn gets to ring the treatment bell on Tuesday because hes been discharged, and then he can come back and ring it again once all the T cells come in and he can fight infection himself again. That will be on day 100 and were on about day 34 so far.

Its still very early days but hes just done outstandingly well. Finn looks amazing, hes so bright and bubbly and laughing all the time.

Were back in time for his birthday too he turns eight on January 19 and we thought he might still be in hospital.

Only two per cent of people in the UK are on the stem cell register and the fact that Finley has a rare tissue type makes finding a donor even harder.

Jo said she urged everyone to sign up and register to be a stem cell donor, to give other families like Finns hope.

For more details, visit the UK Stem Cell Register via dkms.org.uk or anthonynolan.org

Read the original post:
Finn the Fabulous to ring treatment bell after leaving hospital - expressandstar.com

Stem Cells Market in The Region Is Anticipated To Expand At a CAGR of 13.8% During the Period from 2017 to 2025 – Market Research Sheets

In theglobal stem cells marketa sizeable proportion of companies are trying to garner investments from organizations based overseas. This is one of the strategies leveraged by them to grow their market share. Further, they are also forging partnerships with pharmaceutical organizations to up revenues.

In addition, companies in the global stem cells market are pouring money into expansion through multidisciplinary and multi-sector collaboration for large scale production of high quality pluripotent and differentiated cells. The market, at present, is characterized by a diverse product portfolio, which is expected to up competition, and eventually growth in the market.

Some of the key players operating in the global stem cells market are STEMCELL Technologies Inc., Astellas Pharma Inc., Cellular Engineering Technologies Inc., BioTime Inc., Takara Bio Inc., U.S. Stem Cell, Inc., BrainStorm Cell Therapeutics Inc., Cytori Therapeutics, Inc., Osiris Therapeutics, Inc., and Caladrius Biosciences, Inc.

As per a report by Transparency Market Research, the global market for stem cells is expected to register a healthy CAGR of 13.8% during the period from 2017 to 2025 to become worth US$270.5 bn by 2025.

Request a Sample of Stem Cells Market Report

https://www.transparencymarketresearch.com/sample/sample.php?flag=S&rep_id=132

Depending upon the type of products, the global stem cell market can be divided into adult stem cells, human embryonic stem cells, induced pluripotent stem cells, etc. Of them, the segment of adult stem cells accounts for a leading share in the market. This is because of their ability to generate trillions of specialized cells which may lower the risks of rejection and repair tissue damage.

Depending upon geography, the key segments of the global stem cells market are North America, Latin America, Europe, Asia Pacific, and the Middle East and Africa. At present, North America dominates the market because of the substantial investments in the field, impressive economic growth, rising instances of target chronic diseases, and technological progress. As per the TMR report, the market in North America will likely retain its dominant share in the near future to become worth US$167.33 bn by 2025.

Investments in Research Drives Market

Constant thrust on research to broaden the utility scope of associated products is at the forefront of driving growth in the global stem cells market. Such research projects have generated various possibilities of different clinical applications of these cells, to usher in new treatments for diseases.Since cellular therapies are considered the next major step in transforming healthcare, companies are expanding their cellular therapy portfolio to include a range of ailments such as Parkinsons disease, type 1 diabetes, spinal cord injury, Alzheimers disease, etc.

Request for a Discount on Stem Cells Market Report -.

https://www.transparencymarketresearch.com/sample/sample.php?flag=D&rep_id=132

The growing prevalence of chronic diseases and increasing investments of pharmaceutical and biopharmaceutical companies in stem cell research are the key driving factors for the stem cells therapeutics market. The growing number of stem cell donors, improved stem cell banking facilities, and increasing research and development are other crucial factors serving to propel the market, explains the lead analyst of the report.

This review is based on the findings of a TMR report, titled, Stem Cells Market (Product Adult Stem Cell, Human Embryonic Stem Cell, and Induced Pluripotent Stem; Sources Autologous and Allogeneic; Application Regenerative Medicine and Drug Discovery and Development; End Users Therapeutic Companies, Cell and Tissues Banks, Tools and Reagent Companies, and Service Companies) Global Industry Analysis, Size, Share, Volume, Growth, Trends, and Forecast 20172025.

About Us

Transparency Market Research is a next-generation market intelligence provider, offering fact-based solutions to business leaders, consultants, and strategy professionals.

Our reports are single-point solutions for businesses to grow, evolve, and mature. Our real-time data collection methods along with ability to track more than one million high growth niche products are aligned with your aims. The detailed and proprietary statistical models used by our analysts offer insights for making right decision in the shortest span of time. For organizations that require specific but comprehensive information we offer customized solutions through adhoc reports. These requests are delivered with the perfect combination of right sense of fact-oriented problem solving methodologies and leveraging existing data repositories.

TMR believes that unison of solutions for clients-specific problems with right methodology of research is the key to help enterprises reach right decision.

ContactTransparency Market ResearchState Tower,90 State Street,Suite 700,Albany NY 12207United StatesTel:+1-518-618-1030USA Canada Toll Free:866-552-3453Email:[emailprotected]Website:http://www.transparencymarketresearch.com

This post was originally published on Market Research Sheets

View post:
Stem Cells Market in The Region Is Anticipated To Expand At a CAGR of 13.8% During the Period from 2017 to 2025 - Market Research Sheets

Rewriting Our Genes Is Easier Than Ever. That Doesn’t Mean We Should Do It – WBUR

Gene-editing technologies have huge potential to alleviate human suffering. But, like all very powerful technologies, they also carry enormous risks if used improperly.

In November 2018, a team of scientists in China led by Dr. He Jiankui revealed shocking news at a conference: hed used CRISPR-Cas9 (often referred to as just CRISPR) to edit the genes of three embryos.

Two of the embryos were successfully implanted in a surrogate, resulting in twin girls. Now known only as Nana and Lulu their identities protected in scientific version of the witness protection program Dr. He said hed used CRISPR to immunize the embryos to HIV. But he acted against worldwide guidelines and regulations to do so. Those regulations prohibited germline edits, or genetic edits that are heritable to the edited organisms future offspring. (Dr. He and his collaborators were recently sentencedto three years in prison for conducting "illegal medical practices," but no prison sentence can undo the harm he did.)

Lets back up.

Gene editing is what it sounds like: modifying an organisms genes. The technology has a massive range of applications, and those applications carry different degrees of risk, depending on the kinds of cells edited.

Maybe you remember the distinction of somatic versus non-somatic cells from biology? If not, heres a refresher: its the difference between cells involved directly in reproduction (non-somatic) and cells not involved in reproduction (somatic). Most of your cells are somatic: your eyes, your lungs, your heart. For non-somatic, think sperm, eggs, embryos, stem cells: the cells directly used to create offspring. The difference is relevant because genetic modifications to reproductive cells get passed on to the descendants of those organisms.

In essence, if you edit an organisms somatic cells (kidneys, blood, etc), that edit dies when the organism does. If you edit non-somatic cells, and the organism reproduces, its offsprings reproductive cells will have the same edit, which will be passed on and on, as long as the edited organisms genetic line keeps reproducing.

The results of Dr. He's genetic edits to embryos demonstrated the reasons for the ban on human germline editing: he might have inadvertently made unintended edits to the embryos other genes. His rogue experiments consequences might have significant adverse effects for Nana and Lulu, whose germline, or non-somatic genes, he edited.

And CRISPRs no longer the only gene-editing game in town. There was news last fall of a new gene-editing technology called "Prime-Editing." The developers claim its more precise than CRISPR.

The majority of the scientific community continues to agree on a moratorium on human germline editing. But that word, moratorium, has a temporary connotation, and some scientists are likely to agitate for human germline editing with this new technology, despite the widely acknowledged disaster of Dr. He's first foray. Some might argue that this more precise method of gene editing would be safe to use for human germline edits.

That argument pushes us towards a risk we shouldnt take. Prime-Editing is more precise than CRISPR, but that doesnt make it safe for this purpose. If germline gene editing goes wrong, theres no ethically sound way to stop the resulting domino effect.

... there is no precedent -- nor should there be -- for preventing a person who hasn't even been born yet from reproducing as an adult

Gone wrong, germline gene editing has the potential to do widespread damage. Consider the recent finding that all living human beings descended from one woman who lived in the area we now call Botswana. Scientists have referred to this common ancestor as Mitochondrial Eve. Take her as an example an extreme, but real, example of the potential reach of one individuals genes.

Editing an embryos germline genes means that youre altering the genetic code of that person, for life and, if that individual has a baby, they may pass on those altered genes to that baby.

If Nana or Lulu have children, theyll pass on the germline edits Dr. He made both the intended and the unintended. When they come of age, Nana and Lulu will have to have a version of the where babies come from? talk that no human being has ever before experienced, or should have to.

The only way to prevent the future transmission of germline edits is to prevent the person whose genes have been edited from reproducing. Nana and Lulu couldnt have possibly consented to that as a condition of the experiment, because they werent alive when the experiment was performed. Limiting their reproductive possibilities in that way would approach eugenics.

A more precise technology might be better, but it still isnt perfectly precise.

Internal review boards, the ethics committees that review proposed scientific research, make many fraught calculations, but there is no precedent nor should there be for preventing a person who hasn't even been born yet from reproducing as an adult. Its the internal review boards' job to contain possible problems, but they can't contain this problem without causing another.

The if we can do it, we will argument doesnt hold with what todays technology makes us capable of. We shouldnt follow the hinge of every if, then to an unknown, potentially catastrophic outcome. We have to set some hard limits on what well do with the technologies we develop.

This is one such example.

Follow Cognoscenti on Facebook and Twitter.

More here:
Rewriting Our Genes Is Easier Than Ever. That Doesn't Mean We Should Do It - WBUR

Deficiency of TRPM2 leads to embryonic neurogenesis defects in hyperthermia – Science Advances

INTRODUCTION

The cerebral cortex is the most evolved and complicated structure in the mammalian brain and has many physiological functions, such as attention, cognition, learning, and memory. The functions rely on the detailed cortex structure, which includes a six-layered architecture formed by migrating neurons in an inside-out pattern (1). These plentiful neurons are generated from various neural progenitor cells (NPCs). The primary progenitor cells are radial glial (RG) cells, which are mainly responsible for self-renewal and result in the expansion of the cortex, the differentiation of neurons, and the production of postmitotic neurons (2). The process of neuronal production, also known as neurogenesis, plays crucial roles in cerebral development and can affect the function of the neocortex. Generally, each process in neurogenesis, including self-renewal, differentiation, and the maturation of neurons, is strictly regulated, and any disturbance leads to severe disorders (3). The entire process is regulated by numerous extracellular and intracellular signals and factors. Any stress or unusual stimulus may lead to abnormalities in brain function.

During pregnancy, various stimuli can lead to abnormal neural development (4, 5). Among them, heat stress is an important stimulus for both the mother and fetus during pregnancy, and maternal thermal homeostasis is critical for fetal survival and ontogenesis. For example, maternal fever during the gestation period is associated with congenital heart defects and neural tube defects (6, 7). However, it is largely unknown whether heat stress, such as hyperthermia, disturbs neurogenesis and cortical development.

A series of thermally activated ion channels has been reported to detect the entire thermal range (8, 9). Among them, transient receptor potential channel M2 (TRPM2) is a plasma membrane calcium-permeable cation channel and is a unique member of the TRP family that is sensitive to various signals. Recently, studies have reported that TRPM2 can be activated by heat and that the deletion of TRPM2 in mice results in a remarkable deficit in their perception of nonpainful warm stimuli in the range of 33 to 38C (10). TRPM2 has been implicated in several neurodevelopmental/neurological disorders including bipolar disorder, neuropathic pain, and Parkinsons disease (11). In addition, TRPM2 has been shown to participate in various biological processes, including insulin secretion, H2O2-induced cell apoptosis, and brain damage following ischemic insults in adult and neonatal mice (1214). Therefore, it is crucial to investigate the precise functions and molecular mechanisms of the hyperthermia-related protein TRPM2 and characterize the proteins role in the regulation of brain development during heat stress and maternal hyperthermia.

Several pieces of evidence have demonstrated that canonical Wnt signaling, including -catenin, which acts as a core downstream effector, determines the transition from neuronal proliferation to differentiation during cortical neurogenesis. In the early stages of neurogenesis, the overexpression of -catenin in NPCs promotes their proliferation, whereas a deficiency in -catenin in NPCs facilitates neurogenesis (15). The precise signal transductions that modulate neurogenesis are unclear and need further elucidation. The transcription factor SP5 (specificity protein 5) is a member of the SP transcription factor family (16), and previous studies have shown that SP5 plays a crucial role in governing mouse embryonic stem cell pluripotency (17) and neural crest specification (18). During vertebrate development, SP5 acts downstream of Wnt/-catenin signaling in neuroectoderm patterning (19). In addition, the hypermethylation of SP5 has been implicated in schizophrenia, a neuropsychiatric disorder associated with the dysregulation of neural stem cell (NSC) proliferation and differentiation (20, 21). However, the role of SP5 in hyperthermia during neurogenesis has never been reported.

Here, we demonstrate that the thermo-sensor protein TRPM2 is enriched in the embryonic cerebral cortex and that its expression gradually increases during heat stress. We also show that TRPM2-deficient mice exposed to heat show reduced NSC proliferation and a premature shift in RG differentiation. Mechanistically, this study identifies an important role of TRPM2 in modulating SP5 expression by inhibiting the phosphorylation of -catenin in sustaining neural progenitor self-renewal during heat stress. In addition, the heat-induced proliferation defects caused by TRPM2 knockdown or knockout can be partially rescued by the overexpression of SP5. Collectively, these findings reveal that the heat sensor protein TRPM2 has a previously unidentified role in modulating cortical neurogenesis during hyperthermia conditions. These findings provide previously unknown insights to further elucidate neurological disorders associated with heat stress and reveal previously unidentified strategies for treatment.

To determine the effect of heat stress on the developing cortex, we performed stress experiments in which pregnant mice were placed in a thermostatic biochemical incubator (fig. S1A) set to 38C for 2 hours from embryonic day 13.5 (E13.5) to E15.5; the control group was kept at room temperature. After heat stress, E15.5 brain slices were stained with an antibody against mitotic index PH3. Compared with that in the control group, the number of PH3-positive cells residing at both the apical and basal positions was notably augmented, indicating that heat stress promoted mitotic activity (Fig. 1, A to C). Consistently, double staining for bromodeoxyuridine (BrdU) with PAX6 (one type of neural progenitor marker) (Fig. 1, D and E) and TBR2 (an intermediate progenitor marker) (Fig. 1, F and G) revealed that the number of cells in the proliferative state was increased in hyperthermia. Collectively, these results indicate that heat stress promotes neural progenitor self-renewal. In a second group of pregnant mice, similar heat stress was induced at E13.5 to E16.5; then, in utero electroporation (IUE) was performed to analyze embryonic brain development. When embryos were electroporated with a green fluorescent protein (GFP)encoding plasmid, which was used as a control plasmid on E13.5 and collected on E16.5, the hyperthermia group showed an abnormal distribution, which manifested as an increase in the number of cells in the ventricular zone/subventricular zone (VZ/SVZ) and a reduction in the number of GFP-positive cells in the cortical plate (CP) compared with those in the room temperature group (Fig. 1, H and I). In our research, the control mice were maintained in the vivarium at room temperature. We also conducted IUE experiments when mice were maintained in an incubator or in the vivarium at room temperature and found that the stress experienced by the mother due to moving to a new environment did not play a role in the observed phenotypes (fig. S1, B and C). Together, these results demonstrate that heat stress may disturb neurogenesis during embryonic brain development.

(A to C) E15.5 brain sections from the room temperature and hyperthermia groups were immunolabeled with the mitotic marker PH3 and 4,6-diamidino-2-phenylindole (DAPI). The graphs show the number of PH3+cells per 100 m2 at the apical and basal positions (n = 6). Scale bar, 20 m. (D to G) Mice underwent 2 hours of BrdU pulse labeling and were euthanized at E15.5. Brain slices were then double stained with antibodies against BrdU/PAX6 and BrdU/TBR2. The graphs show the populations of BrdU+PAX6+ and BrdU+TBR2+ cells relative to the total population of BrdU+ cells (n = 6). Scale bars, 20 m. (H and I) Thermal stimuli lead to the abnormal distribution of GFP-positive cells in the developing neocortex. An electroporation experiment was conducted at E13.5, and embryonic brains were collected on E16.5. The percentage of GFP-positive cells in each region is displayed in the bar graph (n = 6 embryos from four different mothers). Scale bar, 50 m. IZ, intermediate zone. (J) Reverse transcription polymerase chain reaction (RT-PCR) results showing the relative mRNA levels of members of the TRP family in the heat stress experiment (n = 3). n.s., not significant. (K) TRPM2 is abundantly enriched in NESTIN-positive NSCs in the embryonic cerebral cortex. E13.5 and E15.5 brain slices were immunostained with anti-NESTIN and anti-TRPM2 antibodies (VZ/SVZ) (n = 5). Scale bars, 20 m. (L) TRPM2 is expressed and colocalized with SOX2 and NESTIN in primary NSCs. The cells were collected from the cerebral cortex of E12.5 mouse brains and maintained in proliferative medium for 24 hours (n = 4). Scale bars, 20 m. (M and N) TRPM2 expression increases at warm temperatures in the E15.5 cerebral cortex. E15.5 brain sections were stained with an antibody against TRPM2. The graph shows the relative expression intensities of TRPM2 (n = 6). The intensity of TRPM2 was quantified with ImageJ. Scale bar, 20 m. The data are shown as means SEM; two-tailed Students t tests; *P < 0.05, **P < 0.01, and ***P < 0.001 versus the indicated group.

It has been reported that many receptors are thermally sensitive (10). To verify heat sensitivity, we housed pregnant mice with E13.5 fetuses at 38C for 2 hours for 3 days. Control pregnant mice were kept at room temperature. After 3 days (i.e., E15.5), RNA was extracted from the cerebral tissues of fetal mice. We detected the RNA levels of several receptors associated with heat (10, 22) and observed that in mice subjected to heat stress, the mRNA levels of only TRPM2, among the numbers of the TRP family, increased significantly (Fig. 1J). Molecular markers of heat-sensitive neurons within the preoptic hypothalamus were also affected. BDNF and PACAP mRNA levels increased (fig. S1D), which is consistent with previous studies (23). To examine the specific expression pattern of TRPM2 in the early embryonic brain, we conducted immunofluorescence and colocalization analyses. In vivo, the brain sections of E13.5 and E15.5 mice were collected and stained with antibodies against TRPM2 and the two neural progenitor markers, namely, NESTIN (24) and SOX2 (sex-determining region Yrelated HMG box 2). TRPM2 was observed to be colocalized with NESTIN-positive and SOX2-positive progenitor cells and resided in the VZ/SVZ of the cerebral cortex in both E13.5 and E15.5 brain sections from mice housed at room temperature (Fig. 1K and fig. S1E). In addition, in vitro, we observed that TRPM2 was coexpressed with NESTIN and SOX2 in primary mouse NSCs derived from E12.5 cerebral tissues and cultured in proliferation medium for 2 days (Fig. 1L). Next, to investigate TRPM2 expression at different developmental stages, we harvested cerebral tissues from E13.5, E15.5, and E18.5 and analyzed them using Western blotting. The results revealed that TRPM2 expression gradually increased from E13.5 to E18.5 (fig. S1, F and G). We also investigated TRPM2 transcription in vivo using cortical tissues and in vitro using NPCs cultured under differential or proliferative conditions. Reverse transcription polymerase chain reaction (RT-PCR) was performed on RNA extracted from the tissues or the NPCs. All data indicated that the mRNA levels of TRPM2 showed an obvious up-regulation as embryonic development proceeded (fig. S1, H to J). In addition, another group of pregnant mice was housed at 38C for 2 hours for 3 days at E15.5. Heat-treated mice showed a marked augmentation of TRPM2 expression in the VZ/SVZ of the neocortex compared with that in control mice (Fig. 1, M and N). Overall, these findings suggest that TRPM2, especially during heat stress, plays an important role in modulating NSC neurogenesis during embryonic cortical development.

On the basis of the distinctive expression pattern of TRPM2 in NSCs, we explored whether TRPM2 plays a unique role in neurogenesis during embryonic brain development. We generated a TRPM2-targeting short hairpin RNA (shRNA) plasmid and a TRPM2-overexpressing lentiviral-based vector to effectively silence and augment TRPM2 expression, respectively, in neural progenitors. In NPCs (Fig. 2, A and B, and fig. S1M), N2A cells (fig. S1, L and O), and 293FT cells (fig. S1N) treated with our constructs, Western blotting confirmed TRPM2 knockdown or overexpression. To verify our strategy, we further confirmed TRPM2 shRNA knockdown efficiency by real-time PCR analysis in NSCs, and the analysis showed that TRPM2 levels were effectively suppressed (fig. S1K). Next, we investigated whether TRPM2 disturbs cell distribution in vivo using IUE. In E13.5 mice, brains were injected and electroporated with the TRPM2 shRNA or control plasmid, and the mice were sacrificed at E16.5 for phenotypic analysis. We observed no obvious change in the distribution of GFP-positive cells across the cerebral cortex (fig. S2, A and B). However, the more interesting observation was that when maternal mice were placed in a 38C temperature-controlled incubator for 2 hours from E14.5 to E16.5, TRPM2 knockdown resulted in an obvious reduction in the number of GFP-positive cells in the VZ/SVZ and a corresponding increase in the number of GFP-positive cells in the CP (Fig. 2, C and D). When a 39C temperature-controlled incubator was used, similar results were obtained (fig. S2, C and D). To observe more long-term effects, we performed IUE at E13.5 to E17.5 and comparable GFP-positive cell distributions were observed (fig. S2, E and F). In addition, we also sought to determine whether the knockdown of TRPM2 has a possible effect on cell migration. IUE experiments are frequently used to monitor cell migration during embryonic cerebral development (2527). Then, we performed an E15.5-to-E19.5 IUE experiment in mice at room temperature and an E14.5-to-E18.5 IUE experiment in mice exposed to heat (fig. S2, G to I) and found that there was nearly no difference in GFP distribution from the VZ/SVZ to the CP between the control and TRPM2 knockdown groups. These results jointly eliminated the influence of TRPM2 depletion on cell migration. Thus, the data suggest that TRPM2 may take part in regulating neurogenesis during heat stress.

(A) Western blot analysis confirmed the knockdown (empty pSicoR shRNA was used as a control) of TRPM2 in cultured NSCs. -Actin was used as a control. (B) The graph shows that TRPM2 expression levels were effectively knocked down in primary NSCs by TRPM2-shRNA (n = 6). (C and D) TRPM2 knockdown alters the distribution of cells in the cerebral cortex during heat stress. A control or TRPM2 shRNA plasmids were microinjected and electroporated into the brains of E13.5 mice, and brains were collected on E16.5. During the process, the mice were exposed to 38C for 2 hours per day from E14.5 to E16.5. The GFP-positive cell populations in each region are displayed in the bar graph (n = 6 embryos from four different mothers). Scale bar, 50 m. (E and F) The number of TUJ1+GFP+ cells is augmented in TRPM2 shRNAtreated animals subjected to heat stress. Brain slices from E16.5 mice were stained with an antibody against TUJ1. The population of TUJ1+GFP+ cells relative to the total population of GFP+ cells is shown in the bar graph (n = 6 embryos from four different mothers). Scale bar, 50 m. (G and H) The number of MAP2+GFP+ cells is slightly increased in TRPM2 shRNAtreated animals in hyperthermia. E16.5 brain slices were stained with an anti-MAP2 antibody. The population of MAP2+GFP+ cells relative to the total population of GFP+ cells is shown in the bar graph (n = 6 embryos from four different mothers). Scale bar, 50 m. (I) Silencing TRPM2 induces NPC terminal mitosis during heat stress. A TRPM2 shRNA or control plasmid was injected and electroporated into E13.5 mouse brains. BrdU was gently injected 24 hours after electroporation at E14.5, and the electroporated brains of the embryos were collected for analysis at E18.5. Immunohistochemical analysis was performed using anti-BrdU and anti-CUX1 antibodies. During the process, the mice were exposed to 38C for 2 hours per day from E14.5 to E18.5. The arrowheads represent BrdU+/GFP+ cells, and the arrows represent GFP+BrdU+CUX1+ cells. Scale bar, 20 m. (J) Bar graph displaying the population of BrdU+GFP+ cells relative to the total number of GFP-positive cells in the CP (n = 6 embryos from four different mothers). (K) Quantification of the population of GFP+BrdU+CUX1+ cells relative to the population of GFP+BrdU+ cells (n = 6 embryos from four different mothers). The data are shown as means SEM; two-tailed Students t tests; *P < 0.05, **P < 0.01, and ***P < 0.001 versus the indicated group.

On the basis of the reduction in the number of GFP-positive cells in the VZ/SVZ, which enriches NPCs, we considered the possibility that TRPM2 plays a vital role in modulating NSC proliferation in hyperthermia. To address this possibility, we injected BrdU into pregnant mice 2 hours before the collection of electroporated embryonic brains. In TRPM2 knockdown mice, heat stress at E13.5 to E16.5 led to a marked reduction in the percentage of GFP+BrdU+ cells (fig. S3, A to C), the percentage of GFP+BrdU+PAX6+ cells (fig. S3, D and E), the expression of mitotic marker PH3 (fig. S3, F and G), and the expression of TBR2 (fig. S3, H and I) in NPCs residing in the VZ/SVZ.

Together, these results indicate that TRPM2 is vital for maintaining the NSC pool. To further explore whether a decrease in NPC proliferation leads to precocious cortical neurogenesis, we analyzed cell cycle exit. After electroporating control or TRPM2-shRNA plasmids into embryonic brains at E13.5, BrdU was injected 24 hours before the collection of electroporated brains from embryos on E15.5 and from E14.5 to E16.5. During the process, the pregnant mice were kept at 38C for 2 hours per day. Next, we stained brain slices with antibodies against BrdU and the proliferative marker KI67 to evaluate cells that precociously exit the cell cycle. We observed a substantial augmentation of the indicator of cell cycle exit in the TRPM2-silenced group that was subjected to heat stress, confirming that the elimination of TRPM2 facilitated cell cycle exit in response to hyperthermia (fig. S4, A to C).

To verify the possibility that TRPM2 knockdown NPCs that exit the cell cycle during heat stress may differentiate prematurely into neurons, we stained brain sections with an antibody against TUJ1 (-III-tubulin, a neuronal marker) to label neurons. Analysis revealed an obvious change in the percentage of TUJ1+/GFP+ cells in brain slices from TRPM2 knockdown mice subjected to heat stress (Fig. 2, E and F). We also observed a remarkable increase in the number of cells expressing the neuronal or upper layer markers MAP2+/GFP+ (Fig. 2, G and H), SATB2+/GFP+ (fig. S4, D and E), and CUX1+/GFP+ (fig. S4, F and G) and a decrease in the number of cells expressing CTIP2 (a marker of deep layer neurons)+/GFP+ (fig. S4, I and J) compared to those in control brain slices, suggesting an increase in the differentiation of NSCs. We also birthdated neurons using BrdU to investigate whether TRPM2 knockdown accelerates the terminal mitosis of premature neural progenitors in mice challenged with heat. As previously described (28), BrdU was injected into the abdominal cavity of pregnant mice 24 hours after the electroporation of E14.5 fetuses, and the electroporated brains of the embryos were collected for analyses at E18.5 (fig. S4H). Because BrdU labels dividing cells in the S phase (29), the label becomes diluted and gradually disappeared upon the self-renewal of NPCs. Only cells that differentiate into neurons within the CP layer during their final mitotic division are permanently labeled. By staining with an antibody against BrdU, we observed a marked increase in the number of BrdU+/GFP+ (Fig. 2, I and J) cells in the TRPM2 shRNAtreated brains compared with control shRNAtreated brains. When colocalized with the outer cortical layer marker CUX1, a significant change in the percentage of CUX1+GFP+BrdU+ cells relative to that of GFP+BrdU+ cells in the TRPM2 shRNAtreated group was observed. These results indicate that more BrdU-labeled NPCs differentiated into CUX1-positive neurons in the CP in the TRPM2 shRNAtreated group (Fig. 2K). Collectively, these findings effectively demonstrate that during heat stress, TRPM2 loss of function results in augmented terminal mitosis and enhanced cortical neuronal differentiation.

To verify the role of TRPM2 in neuron development under conditions of heat, we conducted an in vitro experiment using cultured primary NSCs. NPCs obtained from the E12.5 cerebral cortex were infected with either a control or TRPM2 shRNA plasmidpackaged lentivirus. After 24 hours, the cells were then incubated at 38C for 3 days in proliferative medium and finally stained with antibodies against TUJ1 and KI67. We observed an obvious increase in the number of GFP+TUJ1+ cells (fig. S5, A and B) and a marked decrease in the number of GFP+KI67 + cells (fig. S5, C and D) in TRPM2-deficient cells compared with control cells, supporting our in vivo findings. However, when NPCs were incubated at 37C for 3 days, we observed no obvious change in the percentage of GFP+TUJ1+ cells in the TRPM2-deficient cells (fig. S6, H and I).

To further investigate the effects of TRPM2 on NPC morphology during heat stress, we kept NSCs acquired from E12.5 brains in differentiation medium at 38C for 3 days. Using confocal imaging, we observed that compared with control NSCs, TRPM2 knockdown NSCs exhibited longer neurite outgrowth and increased branching after hyperthermia (fig. S5, H to J).

In addition, IUE was performed at E13.5, and the GFP-positive region of the brains from the embryo was collected and digested 2 days after electroporation at E15.5. During E14.5 to E15.5, the pregnant mothers were held at 38C for 2 hours per day. Embryonic GFP-positive brain cells were acquired using fluorescence-activated cell sorting and then cultured for 2 days in proliferative medium at 38C. Notably, TRPM2-silenced cells obtained from embryos whose mothers were heat-challenged showed prominent branching and longer neurite outgrowth compared with empty vectortreated cells (fig. S5, E to G). Jointly, these results suggest that TRPM2 can inhibit neuronal development during heat stress and is required for maintaining stem cell self-renewal.

In E13.5 mice electroporated with a TRPM2 overexpression vector, we observed a prominent increase in the number of GFP-positive cells residing in the VZ/SVZ and a corresponding decrease in the number of GFP-positive cells in the CP at E16.5 when pregnant mothers were subjected to heat stress for 2 hours from E14.5 to E16.5 (fig. S6, A and B). Compared to the normal expression of TRPM2, TRPM2 overexpression during heat stress also led to more BrdU-positive cells in the VZ/SVZ (fig. S6, C to E), supporting a role for TRPM2 in promoting NSC proliferation. In addition, TRPM2 overexpression was found to rescue abnormal NPC distribution caused by the depletion of TRPM2 in vivo (fig. S6, F and G), demonstrating that TRPM2 is required for the proliferation of NPCs during heat stress.

To further explore the phenotype of TRPM2 knockout mice, we generated mice using the CRISPR-Cas9 system through zygote microinjection. The coding sequence (CDS) of TRPM2 is located in exon 3, but not exon 1. After CRISPR editing, a termination codon was introduced near the start codon in the CDS (Fig. 3A). Genotyping PCR (Fig. 3B), Western blotting (fig. S7A), and real-time PCR (fig. S7B) were all performed to identify the knockout efficiency at the genome, protein, and RNA levels, respectively. We verified the knockout of TRPM2 in pregnant TRPM2 knockout mice exposed to hyperthermia at E14.5 to E16.5 by immunostaining E16.5 brain slices with an antibody against TRPM2 (fig. S7C). In addition, by immunostaining with an antibody against cleaved caspase-3, we observed that, in hyperthermia, there was no significant difference in the number of cleaved caspase-3+ cells per field between E16.5 TRPM2+/+ and TRPM2/ brain slices, suggesting that TRPM2 knockout had no effect on cell apoptosis under conditions of heat (fig. S7, D and E).

(A) Schematic diagram of the generation of TRPM2 knockout mice. (B) Genotyping of TRPM2+/+ and TRPM2/ mice. The results show that the PCR products of TRPM2+/+ and TRPM2/ were 1291 and 511 base pairs (bp), respectively. WT, wild type. (C and G) E16.5 brain slices from TRPM2+/+ and TRPM2/ mice were stained with DAPI and an antibody against PH3. Heat stress was applied from E14.5 to E16.5. The graph shows the number of PH3-positive cells per 100 m2 in the VZ/SVZ (n = 6). Scale bar, 20 m. (D and H) TRPM2+/+ and TRPM2/ mice underwent 2 hours of BrdU pulse labeling and were sacrificed at E16.5. Brain slices were then stained with antibodies against BrdU and PAX6. The graph shows the number of BrdU+PAX6+ cells per 100 m2 in the VZ/SVZ (n = 6). Scale bar, 20 m. (E and I) Coronal brain slices of E16.5 TRPM2+/+ and TRPM2/ mice were immunostained with an anti-CUX1 antibody. The number of CUX1+ cells per 100 m2 of CP is shown (n = 6). Scale bar, 20 m. (F and J) Representative images of E16.5 cortices showing SATB2-labeled cells. The graph shows the thickness of SATB2+ cells in the upper layer of the CP (n = 6). Scale bar, 20 m. (K) Deletion of TRPM2 leads to abnormal cell distribution and neurogenesis defects during heat stress. Furthermore, these defects were rescued by the constitutive expression of TRPM2 in the developing brain. A GFP-expressing control vector or TRPM2 overexpression vector was microinjected and electroporated into E13.5 mouse brains. Heat stress was administered from E14.5 to E16.5 for 2 hours a day. The brains were collected on E16.5 and stained for TUJ1. (L) The population of GFP-positive cells in each region is displayed in the bar graph (n = 6 embryos from four different mothers). Scale bar, 50 m. (M) The population of TUJ1+ GFP+ cells among GFP+ cells is displayed in the bar graph (n = 6 embryos from four different mothers). Scale bar, 50 m. The data are shown as means SEM; two-tailed Students t tests; *P < 0.05, **P < 0.01, and ***P < 0.001 versus the indicated group.

Next, we obtained E16.5 TRPM2+/+ or TRPM2/ embryonic brains from mothers that had been housed at 38C for 2 hours per day from E14.5 to E16.5. By staining analysis, we observed fewer neural progenitors expressing PH3 (Fig. 3, C and G) and BrdU/PAX6 (Fig. 3, D and H) in the VZ/SVZ and more neurons expressing CUX1 (Fig. 3, E and I) and SATB2 (Fig. 3, F and J) in the CP in TRPM2 knockout brain slices. In addition, when immunostaining for TRPM2 together with NESTIN or TUJ1 was performed on E16.5, we found that the expression of NESTIN was decreased, while the level of TUJ1 was observably augmented after the deletion of TRPM2 in hyperthermia (fig. S7, F and G). Consistently, when mice were housed at 38C for 2 hours per day from E14.5 to E18.5, more neurons expressing CUX1 were observed in the CP in TRPM2 knockout brain slices both on postnatal day 0 (P0) and P6 (fig. S8, F to I), which suggests that the heat-mediated shift in the proliferation to differentiation ratio upon TRPM2 knockout has a consistent and longer-term effect in later stages of development. However, in brain slices obtained from embryos of mothers who had been housed at room temperature, we did not find an obvious difference in TUJ1 staining at P0 between the wild-type and TRPM2 knockout groups (fig. S8J). Consistently, progenitors isolated from hyperthermic E12.5 TRPM2/ embryos developed longer neurites and more branching after culture in differentiation medium for 3 days than those of hyperthermic E12.5 TRPM2+/+embryos, while room temperature embryos lacked these phenotypes (fig. S8, A to E). These observations suggest that TRPM2 knockout and hyperthermia accelerate neuron development. In addition, NSCs obtained from E12.5 TRPM2/ embryos formed smaller neurospheres than those of controls in hyperthermia, but not room temperature conditions, suggesting that the loss of TRPM2 inhibits NPC proliferation during hyperthermia (fig. S7, K to M). To validate the function of TRPM2 during cortical neurogenesis in times of hyperthermia, we electroporated the brains of fetal TRPM2+/+ and TRPM2 / mice with control plasmids and brains of fetal TRPM2 / mice with TRPM2 overexpression plasmids on E13.5. Then, on E16.5, we collected brain samples from mice that had been exposed to heat stress for 2 hours from E14.5 to E16.5. By staining with an anti-TUJ1 antibody, we found that TRPM2/ mice not only exhibited an aberrant distribution of GFP-positive cells in three cortical layers but also showed a prominent increase in the proportion of GFP and TUJ1double positive cells compared with that in TRPM2+/+ mice, which is reminiscent of TRPM2 knockdown mice subjected to heat stress. Moreover, forced expression of TRPM2 in TRPM2/ mice in hyperthermia could rescue the abnormalities evoked by the ablation of TRPM2, i.e., both the distribution and ratio of GFP+ TUJ1+ cells (Fig. 3, K to M). In addition, we also compared the distribution and ratio of GFP+ TUJ1+ cells between TRPM2/ mice at room temperature and TRPM2/ mice in hyperthermia groups. The results revealed that, upon exposure to hyperthermia, TRPM2/ mice displayed a significant increase in the number of GFP-positive cells in the CP and the percentage of TUJ1+GFP+ cells (fig. S7, H to J). These findings demonstrate the vital role of TRPM2 during embryonic neurogenesis. In addition, the consistent phenotype of TRPM2 knockout excludes the possibility of potential off-target effects of TRPM2 shRNA in knockdown experiments. To investigate the effect of TRPM2 deficiency on differentiating neurons in hyperthermia, we conducted an in vitro experiment using cultured primary neurons. The neurons were isolated from P0 hyperthermic TRPM2+/+ and TRPM2/ embryos and cultured in differentiation medium for 3 days. By staining with an antibody against TUJ1, we observed no obvious difference between the wild-type and TRPM2 knockout groups in terms of neurite length or number of branches (fig. S8, K to M), suggesting that TRPM2 deficiency induces no phenotype in neurons under heat stress. We also analyzed other stimuli, such as treatment with NaCl (fig. S8, N and Q), change in pH (fig. S8, O and R), and X radiation exposure (fig. S8, P and S), and subsequently found that TRPM2 was not activated by these stimuli. Overall, these findings indicate that well-regulated embryonic cortical development can be disturbed in hyperthermic conditions when TRPM2 is deleted.

To further detail how TRPM2 affects the developing brain in hyperthermia, we sequenced RNA (RNA-seq) to analyze transcriptome-wide changes that arise from the loss of TRPM2. Total RNA was acquired from the cortical tissue of E16 TRPM2 knockout and wild-type mice with mothers that were housed at 38C for 2 hours per day from E14.5 to E16.5. Sequencing was repeated twice for each sample to increase the reliability of the sequencing results. Gene Ontology (GO) analysis revealed that down-regulated genes were associated with cell proliferation and temperature stimuli, including the canonical Wnt signaling pathway, neuronal stem cell division, the detection of temperature stimuli involved in sensory perception, and the negative regulation of cell differentiation. The up-regulated genes were associated with neurogenesis, the regulation of neuronal development, and cell fate commitment (fig. S9A). These data jointly suggest a crucial role for the thermal sensor protein TRPM2 in cortical neurogenesis during hyperthermia. Next, we explored how the deletion of TRPM2 affects neurogenesis at the molecular level during heat stress. Among the differentially expressed genes identified by genome analyses, we selected genes that changed consistently in both sequencing results and finally selected SP5 as a downstream target (fig. S9B and Fig. 4A). To confirm the results of RNA-seq, we performed RT-PCR (fig. S9C) and Western blotting (fig. S9D) and observed that SP5 expression was significantly decreased in samples obtained from the cortex of TRPM2 knockout mice that had experienced heat stress. SP5 is a transcription factor that is downstream of Wnt signaling (17, 19), but the function of SP5 in cortical neurogenesis during hyperthermia has not yet been identified.

(A) The volcano plot indicates differentially expressed genes. The red dots represent up-regulated genes, while the green dots represent down-regulated genes. SP5 is one of the notably down-regulated genes. (B and C) SP5 knockdown results in an abnormal cellular distribution during heat stress. The bar graph shows the population of GFP+ cells in the CP, IZ, and VZ/SVZ (n = 6 embryos from four different mothers). Scale bar, 50 m. (D) Western blot results showing the change in the expression of TRPM2, total -catenin, phosphorylated -catenin, SP5, TUJ1, PH3, and PCNA during heat stress in TRPM2 knockout embryos. Heat stress was applied from E14.5 to E16.5 for 2 hours per day. -Actin was used as the control (n = 3). (E) TRPM2 knockout in vivo during hyperthermia increases GSK3 activity (n = 3). (F) The suppression of TRPM2 in NSCs during heat stress intensifies GSK3 activity (n = 3). (G) Calmodulin (CAM) interacts with GSK3 in hyperthermia (n = 3). (H) Western blot analysis showing changes in the expression levels of TRPM2, total -catenin, phosphorylated -catenin, and SP5 between the brains of room temperature and hyperthermia-exposed embryonic mice. -Actin was used as the loading control (n = 3). (I and J) The intracellular calcium ion concentration increases upon exposure to 38C. After neural stem cells were isolated from the E12.5 cortex cultured at 37C or 38C overnight, they were incubated for 30 min with Fluo-3, and the intracellular calcium fluorescence was quantified with a confocal LSM780 microscope. The graph shows the relative Fluo-3 intensity (n = 30). Scale bar, 15 m. (K) Calcium concentration reduction is caused by TRPM2 knockdown in hyperthermia. NSCs isolated from the E12.5 cortex were infected with a control or TRPM2-shRNA plasmid (red)packaged lentivirus. After 6 hours, the cells were cultured at 38C overnight; then, the calcium concentration was measured (n = 3). Scale bar, 5 m. (L) Western blots showing the expression levels of Flag, total -catenin, and phosphorylated -catenin in primary NSCs with constitutively expressing CAM in hyperthermia conditions. -Actin was used as a control (n = 3). The data are shown as means SEM; two-tailed Students t tests; ***P < 0.001 versus the indicated group.

To investigate the function of SP5 in embryonic brain development, we first stained brain slices with a specific fluorescent antibody against SP5. The in vitro results showed that SP5 was expressed in the nuclei of primary mouse NSCs and was colocalized with progenitor markers, such as NESTIN and SOX2 (fig. S9G). Consistently, SP5 was expressed in vivo in NESTIN-positive NSCs in the VZ/SVZ of the E13.5 cortex (fig. S9H). Furthermore, shRNAs targeting SP5 were constructed, and they effectively silenced the expression of SP5 (fig. S10A). In addition, samples from heat stressexposed mice in which the expression of SP5 was silenced showed an increased number of GFP-positive cells in the CP and a decreased number of GFP-positive cells located in the VZ/SVZ (Fig. 4, B and C). However, the redistribution of GFP-positive cells was not obvious in control mice from mothers that had been housed at room temperature (fig. S10, F and G). Immunostaining for KI67 also showed that fewer GFP+KI67+ cells were observed in the VZ/SVZ in SP5 knockdown mice that had been exposed to heat stress (fig. S10, B and C). In addition, we also found that the percentage of TUJ1-positive cells was obviously increased in neural progenitors that had been infected with an SP5 shRNApackaged lentivirus and had been exposed to hyperthermia (fig. S10, D and E). Overall, these data confirm that SP5 acts downstream of TRPM2 to modulate neurogenesis during heat stress.

To further confirm and elucidate the specific mechanisms by which TRPM2 exerts its effect on NPC proliferation in hyperthermia, we monitored the relative mRNA levels of SP5 and several molecular markers associated with proliferation. Transcription analysis revealed that -catenin mRNA levels were reduced by 40% in TRPM2 knockout NPCs from mice exposed to hyperthermia, while the levels of REST, Hes5, SOX2, CyclinD1, Foxg1, and Olig2 were unchanged (fig. S9C). These findings suggest that -catenin may work together with TRPM2 to regulate embryonic neurogenesis during heat stress. To compare the transcription results to translational outcome, we conducted Western blot analysis. Protein was obtained from E16 cortical tissue from TRPM2 knockout and wild-type mice that were housed at 38C for 2 hours per day from E14.5 to E16.5. Western blot analysis showed an obvious reduction in SP5 and -catenin expression levels. We also found that the phosphorylation levels of -catenin were augmented in TRPM2 knockout mice exposed to hyperthermia. In addition, decreases in expression of the proliferative markers PH3 and PCNA (proliferating cell nuclear antigen) and an increase in the expression of the neuronal marker TUJ1 in TRPM2 knockout mice clarified the role of TRPM2 in embryonic neurogenesis in hyperthermia (Fig. 4D). We obtained similar results in TRPM2 knockdown or TRPM2 overexpression primary NSCs exposed to 38C (fig. S9, E and F). In TRPM2 knockdown NPCs, immunostaining for total -catenin verified that its expression was reduced during heat stress (fig. S10, H and I). We did not observe such an obvious change under room temperature conditions (fig. S6J). Intrigued by the altered phosphorylation levels of -catenin in TRPM2 knockout mice exposed to hyperthermia, we tested the activity of glycogen synthase kinase 3 (GSK3), which is a serine/threonine kinase associated with -catenin phosphorylation. On the basis of the fact that GSK3 activity requires the autophosphorylation of Tyr216 (30), we evaluated protein levels and protein modifications. In TRPM2 knockout mice exposed to hyperthermia, we observed an obvious increase in Tyr216 phosphorylation, suggesting that TRPM2 may negatively regulate GSK3 activity (Fig. 4, E and F). The constitutive overexpression of TRPM2 during hyperthermia intensifies GSK3 activity (fig. S10K). In addition, Western blot analysis showed an increase in the expression of TRPM2, total -catenin, and SP5 and a decrease in the phosphorylation of -catenin (Fig. 4H). Together, these findings suggest that TRPM2 may modulate SP5 transcription by inhibiting the phosphorylation of -catenin and activating -catenin expression.

Intracellular calcium signaling plays key roles in neural development, including neuronal plasticity, neuronal survival, and neurogenesis (31). Studies have shown that intracellular calcium affects the -catenin pathway (32). To further investigate the mechanisms by which TRPM2 plays a role in activating -catenin expression, we measured the calcium ion concentration in NSCs using a confocal microscope and a calcium-sensitive dye. We observed that, when the cells were cultured at 38C overnight, the intracellular calcium levels were significantly increased (Fig. 4, I and J). However, when cells were transfected with the TRPM2-sh1 plasmid with red fluorescent protein (RFP), intracellular calcium decreased (Fig. 4K), suggesting that TRPM2 modulates intracellular calcium. Calmodulin (CAM) is a target of calcium ions within the cell, and once bound to calcium ions, CAM is activated and serves as part of the calcium signal transduction pathway by modulating interactions with various target proteins (33). In our study, we found that CAM interacted with GSK3 (Fig. 4G), and Western blotting showed that phosphorylated -catenin levels were reduced, while total -catenin expression was slightly increased when CAM was overexpressed during heat stress (Fig. 4L). Therefore, these findings suggest that thermal stimuli activate TRPM2, which increases intracellular calcium. Calcium ions can then bind to CAM, thus inhibiting the levels of phosphorylated -catenin and simultaneously activating the expression of -catenin.

On the basis of these results, we suggest that -catenin may enter the nucleus, bind to the SP5 promoter, and modulate the expression level of SP5 during heat stress. To test this hypothesis, we used a luciferase plasmid containing 2 kb of the SP5 promoter and measured luciferase activity (Fig. 5A). We also generated a vector that overexpressed -catenin with a hemagglutinin (HA) tag and characterized its efficiency by Western blotting (fig. S10J). At 39C, we observed more than twofold increase in luciferase activity in cells treated with the -catenin vector compared with cells treated with the empty vector, demonstrating that -catenin binds to the SP5 promoter to exert its function (Fig. 5A). To further determine the specific binding site, we used a chromatin immunoprecipitation (ChIP) assay (Fig. 5B). At 39C, in cells in which -catenin was constitutively expressed, the binding of -catenin 0.5 kb from the SP5 promoter increased, and binding decreased as the distance to the transcription start site increased (Fig. 5B). These differences were not observed at 37C (Fig. 5B). In addition, we analyzed the promoters of other -catenin target genes, such as Axin2 and CyclinD1, in hyperthermia and observed that there was almost no binding of -catenin (fig. S10, L and M), suggesting specificity for SP5.

(A) Flow chart of the luciferase assay in which the SP5 promoter was cloned into the psiCHECK-2 vector. (A) 293FT cells were transfected with an empty vector or a -cateninexpressing vector. Both groups were cotransfected with an SP5 promotercontaining psiCHECK-2 vector and cultured at 39C. After 36 hours of transfection, the relative luciferase activity was quantified and is shown in the bar graph (n = 4). (B) Four pairs of primers were designed for 0.5, 1, and 2 kb from the SP5 transcription start sites and SP5 CDS for ChIP analysis. (B) NPCs cultured in vitro at 39C were infected with a -cateninHAcontaining lentivirus and then pulled down using immunoglobulin G (IgG) or HA-incubated magnetic beads. The relative amount of SP5 promoter was detected via ChIP and real-time PCR and is shown in the bar graph (n = 3). (B) NPCs cultured in vitro at 37C were infected with a -cateninHAcontaining lentivirus and then pulled down with IgG- or HA-incubated magnetic beads. The relative amount of SP5 promoter was determined by ChIP and real-time PCR and is shown in the bar graph (n = 3). (C to F) SP5 overexpression rescues the cortical neurogenesis defects evoked by TRPM2 knockdown (C and D) or knockout (E and F) in hyperthermia. After electroporation (E13.5) and heat stress (E14.5 to E16.5), E16.5 brain slices were stained with anti-TUJ1 antibody. The bar graphs show the percentage of TUJ1+GFP+ cells relative to the total number of GFP+ cells (n = 6 embryos from four different mothers). Scale bars, 50 m. (G) Working model of TRPM2 function in modulating cortical neurogenesis during heat stress. TRPM2 during heat stress increases calcium influx, which inhibits the phosphorylation of -catenin and induces -catenin enrichment on the SP5 promoter, thereby promoting NPC proliferation. The data are shown as means SEM; two-tailed Students t tests; *P < 0.05, **P < 0.01, and ***P < 0.001 versus the indicated group.

To decipher the connection between TRPM2 and SP5 in neurogenesis during heat stress, we performed rescue experiments. We observed that the constitutive expression of SP5 increased the cell populations residing in the VZ/SVZ and ameliorated the irregularity of both the distribution and percentage of GFP+ TUJ1+ cells caused by TRPM2 knockdown (Fig. 5, C and D) and knockout (Fig. 5, E and F) during heat stress in vivo. Therefore, these data demonstrate that SP5 acts downstream of TRPM2 to modulate early cortical development in hyperthermia. Together, our data supported the notion that, during heat stress, TRPM2 increases SP5 levels via the stabilization of -catenin enrichment on the SP5 promoter, thus enhancing NPC proliferation (Fig. 5G).

Cortical neurogenesis is a very sophisticated process that is strictly controlled by a great deal of signaling molecules. If any step of this process goes wrong, abnormal brain functions, and thus neurodevelopmental disorders, result (34). Temperature homeostasis is essential for embryo survival, and heat stress disturbs numerous aspects of fetal development and brain function (35). TRPM2, which has been recently identified as a heat activation protein, plays an important role in the heat response. TRPM2 is also a calcium-permeable channel in the plasma membrane, and a growing body of evidence has shown that calcium signaling heavily affects neural progenitor proliferation during embryonic neurogenesis (10, 36). However, no details as to whether or how TRPM2 affects brain neural development under conditions of heat exist. Here, we used TRPM2 shRNA and knockout mice to investigate the specific functions of TRPM2 in NPC proliferation and differentiation, cortical neuronal morphology, and the mechanisms guiding embryonic neurogenesis under hyperthermic conditions.

In our study, we first confirmed the thermal sensitivity of TRPM2 and then observed that TRPM2 is expressed in NSCs. When expressed during heat stress, TRPM2 augments NPCs in the E15.5 cerebral cortex, providing clues regarding its effect on neurogenesis during hyperthermia. Furthermore, we found that heat stress changes cellular distribution and facilitates NSC proliferation. Previous studies have shown that at room temperature, TRPM2 loss of function leads to increased axonal growth to promote neuronal differentiation (37). Here, we demonstrated that TRPM2 can exert its function earlier, specifically at E13.5, and that during heat stress, the loss of TRPM2 has a more powerful effect on facilitating cortical neurogenesis. However, at room temperature, the phenotype is not obvious. Our data indicate that TRPM2 deficiency in hyperthermia results in a change in cell distribution and proliferation defects with a sharp drop in the NSC pool. We also found that the depletion of TRPM2 during heat stress increases cell cycle exit and premature cell terminal mitosis, ultimately promoting neurons to a more differentiated state. Both proliferation defects and abnormalities in neuronal morphogenesis lead to severe brain illness, such as autism and schizophrenia (38, 39). In addition, we were able to eliminate the influence of cell migration and apoptosis during hyperthermia by knocking out TRPM2. However, why the TRPM2 knockdown phenotype observed during heat stress is more obvious than the phenotype observed under room temperature conditions still needs to be explored.

To investigate the mechanisms underlying the unique phenotype caused by the loss of TRPM2 and hyperthermia, we searched for downstream targets using RNA-seq analysis and found that SP5 expression was decreased upon TRPM2 knockout and hyperthermia. SP5 is a member of the SP1 family of transcription factors, but its function in embryonic brain development is still unclear.

Our research shows that SP5 is abundant in NPCs and that, under conditions of heat, TRPM2 deficiency inhibits SP5 expression from E13.5 to E16.5. This leads to a decrease in the number of GFP-positive cells residing in the VZ/SVZ and results in the promotion of neuronal differentiation. To further decipher how TRPM2 enhances SP5 expression in hyperthermia, we analyzed some signaling molecules and found that total -catenin expression was significantly down-regulated, while the phosphorylation of -catenin was obviously increased upon TRPM2 deficiency and heat stress. -Catenin, which functions in canonical Wnt signaling, is abundant in NSCs and contributes to the modulation of NSC expansion (15). However, specific mechanisms of the protein are not entirely clear. Previous studies have indicated that Wnt/-catenin is associated with intracellular Ca+ (32). Given that TRPM2 is a calcium-permeable channel, we investigated calcium ions during heat stress, and our data showed a decrease in intracellular Ca+ levels upon TRPM2 knockout. Moreover, the overexpression of CAM inhibited the phosphorylation of -catenin and augmented the expression of -catenin. Using a luciferase and ChIP assay, we also confirmed that -catenin binds to the SP5 promoter during heat stress. Unexpectedly, our results indicated that the overexpression of SP5 ameliorates the defects evoked by TRPM2 loss of function in hyperthermia. However, in the future, the current hyperthermia model needs to be further improved because in human, such as fever response, immune system component may take part in this model.

In summary, our findings uncovered a novel mechanism by which TRPM2, a thermo-sensor protein, governs embryonic neural development during heat stress. Furthermore, the neuronal morphology abnormalities in TRPM2 knockout mice exposed to hyperthermia during embryonic development may provide novel insights into neurological disorders associated with heat stress, including maternal fever, and reveal new strategies for treatment. In terms of the mechanism, we found that when TRPM2 is activated by heat and intracellular calcium binds to CAM, the phosphorylation of -catenin is inhibited. Accumulating -catenin then binds to the SP5 promoter to ultimately enhance NPC proliferation.

Pregnant ICR mice were obtained from Vital River Laboratories. All animal-related experiments were conducted in line with the Animal Care and Use Committee of Institute of Zoology, Chinese Academy of Sciences. TRPM2 knockout mice used in our experiments were generated and kept in the Experiment Animal Center of Institute of Zoology, Chinese Academy of Sciences.

To construct shRNA-expressing plasmids, the oligonucleotides were inserted into the pSicoR-GFP (Addgene, 12093) or pSicoR-TOMATO lentiviral vector. The sequences of shRNAs targeting TRPM2 were as follows: TRPM2-sh1, AACCTTAGCTCATGGATTC (13); TRPM2-sh2, GACCTTCTCATTTGGGCCGTT (Sigma). The sequences of SP5 shRNAs were as follows: SP5-sh1, GGATTCAAAGGATTTGCTTTC (17); SP5-sh2, CCCGTCGGACTTTGCACAG (Sigma). The full-length complementary DNAs (cDNAs) of mouse TRPM2, SP5, and CAM were obtained via PCR and cloned into the Flag-tagged pCDH (System Biosciences, CD511B-1) vector for lentivirus packaging.

Human 293FT cells and mouse N2A cells were cultured in Dulbeccos modified Eagles medium (DMEM) that contained 1% penicillin-streptomycin (PS) and 10% fetal bovine serum (FBS). Mouse cortical NPCs from E12.5 mouse cortex were maintained in proliferation medium, which contained 50% DMEM/F12 (Invitrogen), 50% neural basal medium (Invitrogen), epidermal growth factor (EGF) (10 ng/ml), basic fibroblast growth factor (bFGF) (10 ng/ml) (Invitrogen), 1% PS, and 2% B27 (without vitamin A).

The production of lentivirus was obtained by transfecting the core and packaging plasmids into 293FT cells using GenEscort I (Nanjing Wisegen Biotechnology). The virus was gathered at 24, 48, and 72 hours after changing the medium 6 hours after transfection. The primary NSCs for Western blot and immunofluorescence were seeded in 6- or 24-well plates, which were coated with laminin (Invitrogen) and poly-d-lysine (Sigma) (both 10 g/ml) in advance. Twenty-four hours later, half of the medium was changed with proliferation medium without PS. Lentivirus was then added to each well and maintained for 8 hours. Meanwhile, to improve the infection efficiency, polybrene (2 g/ml) was mixed into the medium. Forty-eight hours later, to induce a differentiation state, the medium was displaced with low-glucose DMEM (Gibco) supplemented with 1% FBS (Invitrogen), 1% PS, and 2% B27 (with vitamin A).

IUE was performed as reported previously (40). In brief, pregnant ICR or C57 mice were deeply anesthetized with pentobarbital sodium (70 mg/kg). Subsequently, the recombinant knockdown or overexpression plasmids with a final concentration of 1500 ng/l were mixed with an enhanced GFP plasmid at a ratio of 3:1. In addition, 0.02% Fast Green was included as a tracer. Then, the mixture was microinjected into the lateral ventricle of the embryonic mouse brains using glass capillaries. Five electric pulses of 40 V (950-ms interval; 50-ms duration) were generated using an electroporator (Manual BTX ECM 830) and platinum electrodes. After IUE, the brains of the embryos were collected at E16.5, E17.5, or P1 for further phenotype analysis.

For neural progenitor proliferation analysis, BrdU (50 mg/kg) was injected 2 hours before brain harvesting at E16.5. For neuronal birth dating, BrdU (50 mg/kg) was administrated to pregnant mice at E14.5. For cell cycle exit analysis, BrdU (100 mg/kg) was administrated to pregnant mice 24 hours before brain collection at E15.5.

For heat stress experiments, mice were maintained in their cages, and the cages were put in a large temperature-controlled incubator set at 38 or 39C for 2 hours each day for 2 or 3 days.

Brain slices or cells cultured in vitro were washed with phosphate-buffered saline (PBS) for 5 min, fixed in 4% paraformaldehyde for 20 min, and blocked in 5% bovine serum albumin (Sangon)/PBS containing 1% Triton X-100 (1% PBST) for 1 hour. Subsequently, the primary antibody was diluted with 1% PBST, added, and then incubated at 4C overnight. The following day, the samples to be visualized were rinsed with PBS three times and incubated with secondary antibodies at room temperature for nearly 1.5 hours. The primary antibodies used for immunofluorescence are listed here: rabbit anti-TRPM2 (1:1000; Bethyl Laboratories), rabbit anti-TUJ1 (1:1000; Sigma), mouse anti-BrdU (1:1000; Millipore), rat anti-BrdU (1:1000; Abcam), rabbit anti-CUX1 (1:100; Santa Cruz Biotechnology), rabbit anticleaved caspase-3 (1:1000; Cell Signaling Technology), rabbit anti-PAX6 (1:1000; Millipore), mouse anti-MAP2 (1:1000; Millipore), mouse anti-NESTIN (1:1000; Millipore), rabbit anti-KI67 (1:1000; Abcam), mouse anti-SATB2 (1:300; Abcam), rabbit anti-SP5 (1:200; Bioss), rabbit anti-TBR2 (1:1000; Abcam), rat anti-CTIP2 (1:1000; Abcam), and mouse anti-SOX2 (1:1000; R&D Systems). Secondary antibodies applied were conjugates of Alexa Fluor Cy3, Cy5, or 488 (1:1000; Jackson ImmunoResearch). 4,6-Diamidino-2-phenylindole (DAPI) (2 mg/ml; Sigma) was used for nuclear staining.

Protein was extracted from brain cortical tissue of mouse or cultured cells by lysing with radioimmunoprecipitation assay buffer (Solarbio), with 10 mM phenylmethylsulfonyl fluoride and a protease inhibitor cocktail (Sigma, P8340). Samples were then ultrasonicated and centrifuged at approximately 12,000 rpm for 15 min at 4C. Subsequently, the supernatants were gathered, and protein concentrations were determined using a BCA kit (Thermo Scientific). Next, similar amounts of protein samples were size-separated by 6 to 12% SDSpolyacrylamide gel electrophoresis gels and shifted onto nitrocellulose membranes (Whatman) making use of a semidry transfer system (Bio-Rad). We run multiple gels and normalized to a control. The primary antibodies applied in the Western blots are listed here: rabbit anti-TRPM2 (1:1000; Bethyl Laboratories and Novus Biologicals), rabbit antitotal -catenin (1:1000; Cell Signaling Technology), rabbit antiP-catenin (S33/S37/T41) (1:1000; Cell Signaling Technology), rabbit antinonP-catenin (S33/S37/T41) (1:1000; Cell Signaling Technology), rabbit anti-PCNA (1:500; Santa Cruz Biotechnology), rabbit anti-TUJ1 (1:1000; Bioward), rabbit anti-SP5 (1:500; Bioss), rabbit anti-PH3 (1:1000; Cell Signaling Technology), rabbit anti-TBR2 (1:1000; Abcam), and rabbit anti-Flag (1:1000; Sigma). Secondary antibodies were 800CW Donkey Anti-Mouse IgG (immunoglobulin G), 800CW Donkey Anti-Rabbit, 680LT Donkey Anti-Mouse IgG, and 680LT Donkey Anti-Rabbit IgG (LI-COR Biosciences). Odyssey v3.0 software was used to scan and quantify Western blot bands.

Total RNA was obtained using TRIzol (Invitrogen, 15596) following the manufacturers directions. Reverse transcription of mRNA to first-strand cDNA was achieved using the FastQuant RT Kit (TIANGEN). Quantitative RT-PCR was conducted using the SYBR Green PCR Kit (Takara) with an ABI PRISM 7500 sequence detector system (Applied Biosystems). All reactions were repeated in triplicate for each sample. The primer sequences used for RT-PCR are listed here: TRPM2, AAGGAACACAGACAATGCCTG (forward) and AGGATGGTCTTGTGGTTCGC; TRPM3, TACACCAAAGTCAGCTCCCTG (forward) and GGCCTCTCGTGGAAAGTCAT (reverse); TRPM7, CCCAGCCAAGTTGCAAAAGT (forward) and CTACAGCTTTCTGCTTGCACC (reverse); TRPM8, GTCCTGTGACACCGACTCTG (forward) and CAGTGAGAATCCACGCACCT (reverse); TRPV1, CTCGGATGAATCTGAGCCCC (forward) and GACAACAGAGCTGACGGTGA (reverse); TRPV3, AGTGCTTATAGCAGCGGGTG (forward) and CGTGCAGGATGTTGTTTCCC (reverse); TRPV4, TCCTCTTCTCTTTCCCCGGT (forward) and GTGCCGTAGTCGAACAAGGA (reverse); ANO1, CGAGAAGTACTCGACGCTCC (forward) and TAGTCCACCTTCCGTTTGCC (reverse); TRPA1, TCTGCATATTGCCCTGCACA (forward) and ACTTTCATGCACTCGGGGAG (reverse); BDNF, TACCTGGATGCCGCAAACAT (forward) and GCCTTTGGATACCGGGACTT (reverse); PACAP, ATGACCATGTGTAGCGGAGC (forward) and CGCTGGATAGTAAAGGGCGT (reverse); -catenin, ATCACTGAGCCTGCCATCTG (forward) and GTTGCCACGCCTTCATTC (reverse) (39); SP5, GGCAAGGTGTACGGCAAAAC (forward) and CATAGGTCCCGCGGATTCTC (reverse); REST, GTGCGAACTCACACAGGAGA (forward) and AAGAGGTTTAGGCCCGTTGT (reverse) (41); Hes5, CGCATCAACAGCAGCATAGAG (forward) and TGGAAGTGGTAAAGCAGCTTC (reverse); CyclinD1, GCCTACAGCCCTGTTACCTG (forward) and ATTTCATCCCTACCGCTGTG (reverse) (42); SOX2, GCACATGAACGGCTGGAGCAACG (forward) and TGCTGCGAGTAGGACATGCTGTAGG (reverse); Foxg1, GGCAAGGGCAACTACTGGAT (forward) and CGTGGTCCCGTTGTAACTCA (reverse); Olig2, GGTGTCTAGTCGCCCATCG (forward) and AGATGACTTGAAGCCACCGC (reverse); -actin, GGTGGGAATGGGTCAGAAGG (forward) and AGGAAGAGGATGCGCCAGTG (reverse).

ChIP was performed as follows. To generate the cross-link, in vitro cultured cells were processed with 1% formaldehyde and maintained at room temperature for 10 min. Subsequently, 2.5 M glycine was then added to terminate the cross-link reaction. After washing three times with sterile PBS, the cells were gathered in lysis buffer. Next, the lysates were incubated with 15 l of Dynabeads Protein G (Invitrogen), which was incubated at least 12 hours with 1 g of specific antibody at 4C before incubation. After washing three times with low- and high-salt buffer, the DNA-protein-antibody complex was incubated overnight at 65C to open the covalent bond. Genomic DNA was then obtained using the TIANamp Genomic DNA Kit (TIANGEN Biotech) for subsequent real-time PCR analysis. The primer sequences applied for SP5 promoter are listed here: SP5-CDS, GGCAAGGTGTACGGCAAAAC (forward) and CATAGGTCCCGCGGATTCTC (reverse); SP5-0.5k, AGCTCGGTTGTGGGAGGAA (forward) and TCTTGACAAGCCGCTTGAAG (reverse); SP5-1k, ACCGCTGCCAGGTCGCT (forward) and AGGCAGGGTCAGTCGGC (reverse); SP5-2k, GCTGGGAACCGGTGGCT (forward) and TTGGGAGTATCCTCTTTGGC (reverse); CyclinD1-CDS, TCAAGACGGAGGAGACCTGT (forward) and TTCCGCATGGATGGCACAAT (reverse); CyclinD1-0.5k, CAGCCTCTTCCTCCACTTCC (forward) and AAGCCCTTCTGGAGTCAAGC (reverse); CyclinD1-1k, TCTACTTTAACAATGGTTTGCTGT (forward) and ACAGGGGAAGTCTTGAGAAGG (reverse); CyclinD1-2k, TCAGACATGGCCCTAAACCT (forward) and CATGACCAGTGTGACTCAAAGC (reverse); Axin2-CDS, CAAATGCAAAAGCCACCCGA (forward) and TGCATTCCGTTTTGGCAAGG (reverse); Axin2-0.5k, TACACACTCCCACCACCGA (forward) and ATCTCTGCTCACAGTTTCGGA (reverse); Axin2-1k, TGGAATGCAGTCTATCCCAGC (forward) and AGAAGCTGTGTGACCAGCCA (reverse); Axin2-2k, CCACCACAATCATCCTGGGT (forward) and TCAACTTTAAGGACTGAGGCCA (reverse).

Global transcriptome analysis was conducted by Annoroad Company. Total RNA samples were first tested for quality and quantity using an Agilent 2100 bioanalyzer. After building the library, high-throughput sequencing was used with the Illumina HiSeq 2500 platform. Our RNA-Seq data were deposited in the Gene Expression Omnibus database with the accession number of GSE113954.

The CRISPR-Cas9 system was used to construct TRPM2 knockout mice. During the process, two guide RNAs (gRNAs) (gRNA5, GCCAGTTCTTCTCCGGTCCAAGG; gRNA3, TATTGCTTCGTCGGAGATTGGGG) were used to cleave the whole genome sequence of TRPM2 to approximately 800 base pairs (bp). The genotyping primers designed for the TRPM2 knockout mice were TRPM2-2717F GAAGGGAAACGGGTGGATGT and TRPM2-4007R GCAGGTCTCCTCAACCAGTC. The length of PCR product was 511 or 1291 bp for TRPM2 knockout mice or wild-type mice, respectively.

Apoptotic cells were identified with immunostaining using an antibody targeting cleaved caspase-3.

293FT cells (4 104) were seeded into a 24-well plate and transfected with 0.5 g of luciferase plasmid containing an SP5 promoter and empty vector or with 0.5 g of luciferase plasmid containing an SP5 promoter and -catenin overexpression vector, using GenEscort I (Nanjing Wisegen Biotechnology). Thirty-six hours after transfection, luciferase activity was measured using the Dual-Luciferase Assay System (Promega) and GloMax 96 Microplate Luminometer (Promega).

All images were taken with a Zeiss LSM780 confocal microscope and analyzed with Photoshop CS6 (Adobe). ZEN 2010 was applied for image acquisition and processing. Brightness or expression quantity was measured using ImageJ when needed.

All statistical analyses in this study were performed and plots were generated using GraphPad Prism7.0 software. Results are represented as means SEM. Two-tailed Students t tests and one-way analysis of variance (ANOVA) were used for statistical comparisons. The differences were regarded as statistically significant with *P < 0.05, **P < 0.01, and ***P < 0.001. n.s. means not significant.

Acknowledgments: Funding: This work was supported by grants obtained from the National Science Fund for Distinguished Young Scholars (81825006), CAS Strategic Priority Research Program (XDA16010301), National Key R&D Program of China (2019YFA0110300 and 2018YFA0108402), National Science Foundation of China (31730033 and 31621004), and K. C. Wong Education Foundation. Author contributions: Y.L. performed the experiments, analyzed data, and wrote the manuscript. J.J. conceived and supervised this project. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read this article:
Deficiency of TRPM2 leads to embryonic neurogenesis defects in hyperthermia - Science Advances

Girl, 3, dies in her parents arms on New Years Day after leukaemia battle – The Sun

A LITTLE girl who won the backing of thousands of strangers online died of leukaemia on New Year's Day.

Esme Handley was just three years old when she passed away.

6

6

The adorable tot was diagnosed with blood cancer at just 22 months, after developing a bruise while she was on a family holiday in Greece.

Her parents Rebecca and Will broke the heartbreaking news on their daughter's Facebook Page, named Esme Lionheart after her love of lions.

They said: If you look to the sky tonight you will see a star shining brighter than any other.

Our darling girl went onwards with her journey at midday today.

"She was peaceful and in our arms and knew how ridiculously adored she was.

Esme Grace Angela Handley 13.08.2016 - 01.01.2020.

Rebecca, 38, and Will, 43, faced a battle to try and save their only daughter following her diagnosis.

They discovered she had the high risk acute myeloid leukaemia during a family trip to Greece before which Esme fell.

6

When a bruise that developed shortly afterwards failed to disappear, the couple Googled Esme's symptoms and became concerned.

She was taken to hospital in Greece where the diagnosis was confirmed.

Esme was given a stem cell transplant in September 2018 alongside three rounds of chemotherapy but after six months the leukaemia returned in the tots bone marrow.

If you look to the sky tonight you will see a star shining brighter than any other. Our darling girl went onwards with her journey at midday today.

The family were not eligible for a second transplant on the NHS and were faced with raising 500,000 privately for the urgent treatment.

In November, her parents admitted that Esme could no longer expect to be cured and said their baby had simply had enough.

They said: Since diagnosis we have often spoken about a metaphorical 'sealed envelope' that contains Esme's fate.

"Yesterday we got to open that envelope and it was not what we had hoped.

The leukaemia is out of control and there is nothing more which can be done.

We have spoken with every single, leading paediatric consultant globally, tried all available drugs (some of which arent even licensed in kids), explored a ridiculous amount of supplements and complementary medicines, had healing circles far and wide sending prayers.....

But its not been enough. We dont get to keep our baby.

6

And to be perfectly honest, even if there was something else they could come up with, right now, Im not sure we would be able to pursue it.

"Its very clear to see that Esme has simply had enough....and who could blame her?

Esme thrives when shes outdoors but all she has known for 18 months is hospitals. The treatment she has had wouldnt be tolerated by most adults.

She has been continually pumped full of drugs; had hundreds of blood transfusions; successfully come through one stem cell transplant; had surgery for three Hickman lines into her heart; had numerous tubes shoved up her nose and drops in her eyes, suffered countless horrendous infections including a type of pneumonia three times; lost her hair; lost her fingernails; vomited daily, had her skin break down, crack, be burnt from chemo; nearly died from sepsis; almost died from anaphylaxis; been blue-lighted to PICU after having a seizure which temporarily left her in a vegetative state thanks to a fungal brain infection....and it goes on.

Whilst we would do absolutely anything for her, ANYTHING, Im also not sure how much more we can tolerate either.

A month later, they described the heartbreaking cocktail of pain management Esme had to bear to soften her ever-increasing suffering".

6

At the time, her parents posted: It's now three weeks to the day that we learnt that Esme's story will not have the happy ending we've all prayed for, three long weeks in which we've had to contemplate the unthinkable and bear witness to Esme's ever-increasing suffering.

In the first couple of weeks one of the biggest difficulties was accepting that the team's goal was no longer to cure but just to manage pain.

This sounds obvious but you suddenly find yourself inexplicably sad that the nurses are no longer asking you for Esme's heart rate or temperature every few hours.

At one point I even found myself crying when I bumped into another child being wheeled to theatre and realised Esme will never have another general anaesthetic.

Instead, getting ahead of Esme's pain has become a full-time occupation for us and the team, and Ezzie is now on an ever-escalating daily mix of paracetamol, topical morphine, oxycodone, ketamine and, most recently, methadone.

6

The psychology team here warn against reading adult meanings into our children's innocent words but it's difficult not to tear up when Esme tells us repeatedly I don't think my bottom's ever gonna get better, it's the hurtiest bottom in the whole world ....or My arm/leg/back/headache is killing me.

They also described how Esme had been bedridden for three months and would never walk again.

But the tot had her own Christmas tree and was even taken out of the Royal Marsden Hospital over the festive period to see Christmas lights in Morden before a screening of Frozen 2 at Everyman Esher.

SIGNS OF LEUKAEMIA EVERY PARENT NEEDS TO KNOW

LEUKAEMIA is a type of blood cancer, some forms of which are more common in children.

There are no specific signs or symptoms which would allow for a doctor to make a diagnosis without lab tests.

In all types of leukaemia symptoms are more commonly caused by a lack of normal blood cells than by the presence of abnormal white cells.

As the bone marrow becomes full of leukaemia cells, it is unable to produce the large numbers of normal blood cells which the body needs.

Thiscan lead to:

BREAK THE FAST Best breakfast ideas to burn fat first thing in the morning

STRANGER DANGER Mum covered in tumours is abused by strangers who think she's contagious

SPICE IS RIGHT Turmeric could help beat cancer as compound in spice may kill tumours

LAST WISH Size 26 mum, 42, sheds staggering 10st to honour her dying mum's wish

WEIGHTY ISSUE How to lose weight fast with the 8 best diets of 2020 including keto & vegan

SINISTER SCAR Chickenpox scar develops into skin cancer 30yrs after woman caught the virus

Exclusive

WEIGH TO GO I lost 9st by counting my steps - after devastating warning from doctors

MUM'S HEARTBREAK My son, 9, died two days after catching flu - kids NEED to get vaccinated

NEW YEAR, NEW ME New Year's resolution helped obese bride lose 8 stone after her wedding

Now Will and Rebecca, of West Norwood, south London, hope to donate money in Esmes name.

They have already raised 425,000 on GoFundMe.

Rebecca said in November: When we began fundraising we were punchy with our target to ensure we had enough for a self-funded transplant and said that whatever remained would go to the CCLG, the UK's leading kids cancer charity.

Given how desperately poor the funding is into paediatric AML research, we feel even more strongly about this now.

So a large chunk of the cash we have remaining (after spending some on novel drugs and supportive care) will be donated to AML research to try and spare future families the pain and anguish we have experienced.

To donate in memory of Esme, visit her GoFundMe page here.

Read the original:
Girl, 3, dies in her parents arms on New Years Day after leukaemia battle - The Sun

Red Shamrock: Fight never over, even when kids beat cancer – Iowa City Press-Citizen

Dick Hakes, Taking Liberties Published 10:13 a.m. CT Jan. 2, 2020 | Updated 11:21 a.m. CT Jan. 2, 2020

Finn is shown with his father, John Hall, during the nearly 18-month period about ten years ago in which the boy battled cancer through chemotherapy, radiation and immunotherapy.(Photo: Special to the Press-Citizen)

John Hall of Iowa City recalls how it all started in early 2009.

Before his son Finns third birthday, the boy started spiking fevers. Then he complained of stiff legs. Then a black eye showed up that would not go away.

A CT scan eventually produced what John said was the worst call I ever received.

A tumor on Finns cheek was traced to another on his adrenal gland. It was stage four neuroblastoma. He had about a 35% to 40% chance to survive it.

What followed was almost 18 months of aggressive treatment at University of Iowa Hospitals and Clinics (UIHC) chemotherapy sessions, two surgeries, two stem cell transplants, radiation and finally immunotherapy, which had just been green-lighted for broader use nationwide.

Those months became a heartbreakingly painful, sleepless, worrisome and all-encompassing ordeal for the entire family especially for Finn.

A recent photo of Finn Hall shows a smiling, cancer-free kid wearing a T-shirt promoting the Red Shamrock Foundation started by his father, John Hall.(Photo: Special to the Press-Citizen)

It worked, however, and the cancer disappeared.

We threw the cancer playbook at him, John said. I give the immunotherapy regiment credit for saving his life. It took care of the remaining cancer cells in the end. He was the first patient to complete that regiment at the U.

But it wasnt long after Finn came home and the family worked to return to a normal life that a new troubling reality emerged that led John to form the Red Shamrock Foundation.

Our only focus was getting past the cancer, he said. But now, because he had received so many harsh treatments at such a young age, we realized Finn would need some type of specialized care for the rest of his life.

Finn is 13 now and leading a pretty normal life, but because chemotherapy killed the seeds of his adult teeth, he still has all of his baby teeth, which will have to be replaced when he becomes an adult. He also has some minor hearing loss, kidney damage and must take growth hormones.

But it could have been a lot worse, John said. After cancer, kids sometimes have serious cognitive issues or chronic heart disease or secondary cancers due to the chemo and radiation. Some lose a limb or an organ.

He says he was amazed to learn that 95% of young cancer survivors can expect some type of serious chronic health condition by the time they reach age 45.

It hit me that people need to know about this, he said. I wanted to raise awareness that youre not done just because you have left the hospital.

John formed his nonprofit in 2011 with the help of friends who could handle obtaining legal status and help design a professional logo and web pages. A shamrock logo with a red heart seemed appropriate, given the familys Irish heritage.

The Red Shamrock Foundation mission is simple: Raise public awareness of the unique needs of kids who survive cancer, plus support survivorship programs and post-cancer research in Iowa.

As detailed on its website at http://www.redshamrock.org, the group sponsors three large fundraising events each year: A trail race at Regina High School in the spring, a golf outing in Mount Vernon in June and a Red Tie Gala during Childhood Cancer Awareness Month in September. Other money comes from donations and an online store operated through One Mission Fund Raising of Mount Vernon.

John Hall of Iowa City founded the Red Shamrock Foundation to raise public awareness that children who survive cancer will often face other medical challenges related to their treatment for the rest of their lives.(Photo: Dick Hakes/Special to the Press-Citizen)

As its director, John meets monthly with his board and often promotes the cause by speaking to civic groups. He says securing about $25,000 from the local 100 Men Who Careorganization a few years ago helped raise our profile in the community. All involved with Red Shamrock are unpaid volunteers.

In the past few years, the nonprofit has donated $110,000 for research projects at the university and through Passport for Care to assemble data on the health and needs of post-cancer patients.

Red Shamrock also provides educational materials for parents and teachers on how to explain cancer to kids and what to expect when a cancer survivor returns to class.

Finn was out of preschool for a year and a half, going through all he went through, then suddenly found himself back at preschool surrounded by 30 active, screaming kids, John said. The teachers were good, but Id drop him off and hed just sit in the middle of the room and cry. It took maybe six months for him to get comfortable again.

Dick Hakes(Photo: Special to the Press-Citizen)

The next step for Red Shamrock, John says, is to try to find a national partner and increase its scope beyond Iowa. A dedicated Team Red Shamrock group that participates in running events in other locations may be the catalyst for this, he said.

He has high praise for UIHC and points out that it now operates a survivorship clinic directed by Dr. Bill Terry, a pediatric oncologist.

The bottom line is to raise awareness of what pediatric cancer patients must face after theyve already fought the battle of their lives,John said. People need to understand that their fight is never over.

John is an Elkader native, a University of Iowa graduate in anthropology and a 30-year resident of Iowa City who works for Coldwell Banker in real estate. His wife Monica is a nurse at UIHC. Finn has an older brother, Sully.

Read or Share this story: https://www.press-citizen.com/story/life/2020/01/02/iowa-city-father-forms-red-shamrock-foundation-after-sons-cancer-fight/2794635001/

See the original post:
Red Shamrock: Fight never over, even when kids beat cancer - Iowa City Press-Citizen